PBK cDNA ORF Clone, Mouse, N-His tag

Cat: MG50887-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PBK Reagents
CRO Services
Product recommended

All PBK Reagents
PBK cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
993 bp
Description
Full length Clone DNA of Mouse PDZ binding kinase with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PBK cDNA ORF Clone, Mouse, N-His tag Alternative Names
2810434B10Rik cDNA ORF Clone, Mouse;AW538537 cDNA ORF Clone, Mouse;D14Ertd732e cDNA ORF Clone, Mouse;TOPK cDNA ORF Clone, Mouse
PBK Background Information

PDZ binding kinase (PBK), also known as TOPK (T-LAK cell-originated protein kinase), is a serine/threonine kinase related to the dual specific mitogen-activated protein kinase kinase (MAPKK) family, and has all the characteristic protein kinase subdomains and a C-terminal PDZ-binding T/SXV motif. PBK is expressed in the testis restrictedly expressed in outer cell layer of seminiferous tubules, as well as placenta. PBK may be enrolled in the activation of lymphoid cells and support testicular functions, with a suggested role in the process of spermatogenesis.This mitotic kinase phosphorylates MAP kinase p38 and seems to be active in mitosis. When phosphorylated, PBK forms a protein-protein interaction with tumor suppressor p53 (TP53), leading to TP53 destabilization and attenuation of G2/M checkpoint during doxorubicin-induced DNA damage. The expression level of PBK is thus upregulated in a variety of neoplasms including hematological malignancies.

Full Name
PDZ binding kinase
References
  • Zakut-Houri R., et al.,(1985), Human p53 cellular tumor antigen: cDNA sequence and expression in COS cells. EMBO J. 4:1251-1255.
  • Lamb P., et al., (1986), Characterization of the human p53 gene.Mol. Cell. Biol. 6:1379-1385.
  • Harlow E., et al.,(1985), Molecular cloning and in vitro expression of a cDNA clone for human cellular tumor antigen p53.Mol. Cell. Biol. 5:1601-1610.
  • PBK cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PBK cDNA ORF Clone in Cloning Vector, Mouse MG50887-G
    PBK cDNA ORF Clone, Mouse, untagged MG50887-UT
    PBK Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50887-ACGLN
    PBK cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50887-ACG
    PBK cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50887-ANG
    PBK cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50887-ACR
    PBK cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50887-ANR
    PBK cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50887-CF
    PBK cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50887-NF
    PBK cDNA ORF Clone, Mouse, C-His tag MG50887-CH
    PBK cDNA ORF Clone, Mouse, C-HA tag MG50887-CY
    PBK cDNA ORF Clone, Mouse, N-HA tag MG50887-NY
    PBK cDNA ORF Clone, Mouse, C-Myc tag MG50887-CM
    PBK cDNA ORF Clone, Mouse, N-Myc tag MG50887-NM
    PBK qPCR Primer Pairs, Mouse MP200858

    PBK cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PBK cDNA ORF Clone in Cloning Vector, Human HG10729-M
    PBK cDNA ORF Clone, Human, untagged HG10729-UT
    PBK cDNA ORF Clone, Human, C-GFPSpark® tag HG10729-ACG
    PBK Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10729-ACGLN
    PBK cDNA ORF Clone, Human, N-GFPSpark® tag HG10729-ANG
    PBK cDNA ORF Clone, Human, C-OFPSpark® tag HG10729-ACR
    PBK cDNA ORF Clone, Human, N-OFPSpark® tag HG10729-ANR
    PBK cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10729-CF
    PBK cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10729-NF
    PBK cDNA ORF Clone, Human, C-His tag HG10729-CH
    PBK cDNA ORF Clone, Human, N-His tag HG10729-NH
    PBK cDNA ORF Clone, Human, C-HA tag HG10729-CY
    PBK cDNA ORF Clone, Human, N-HA tag HG10729-NY
    PBK cDNA ORF Clone, Human, C-Myc tag HG10729-CM
    PBK cDNA ORF Clone, Human, N-Myc tag HG10729-NM
    PBK qPCR Primer Pairs, Human HP100667
    info info
    添加购物车成功! 添加购物车失败!