Quick Order

Mouse PDK / PDZ binding kinase / TOPK ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse PBK cDNA Clone Product Information
NCBI RefSeq:NM_023209.2
RefSeq ORF Size:993bp
cDNA Description:Full length Clone DNA of Mus musculus PDZ binding kinase with N terminal His tag.
Gene Synonym:TOPK, AW538537, D14Ertd732e, 2810434B10Rik, Pbk
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

PDZ binding kinase (PBK), also known as TOPK (T-LAK cell-originated protein kinase), is a serine/threonine kinase related to the dual specific mitogen-activated protein kinase kinase (MAPKK) family, and has all the characteristic protein kinase subdomains and a C-terminal PDZ-binding T/SXV motif. PBK is expressed in the testis restrictedly expressed in outer cell layer of seminiferous tubules, as well as placenta. PBK may be enrolled in the activation of lymphoid cells and support testicular functions, with a suggested role in the process of spermatogenesis.This mitotic kinase phosphorylates MAP kinase p38 and seems to be active in mitosis. When phosphorylated, PBK forms a protein-protein interaction with tumor suppressor p53 (TP53), leading to TP53 destabilization and attenuation of G2/M checkpoint during doxorubicin-induced DNA damage. The expression level of PBK is thus upregulated in a variety of neoplasms including hematological malignancies.

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"