PDIA3 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51751-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PDIA3 Reagents
CRO Services
Product recommended

All PDIA3 Reagents
PDIA3 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1518 bp
Description
Full length Clone DNA of Mouse protein disulfide isomerase associated 3 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDIA3 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
58kDa cDNA ORF Clone, Mouse;Erp cDNA ORF Clone, Mouse;ERp57 cDNA ORF Clone, Mouse;ERp60 cDNA ORF Clone, Mouse;ERp61 cDNA ORF Clone, Mouse;Grp58 cDNA ORF Clone, Mouse;PDI cDNA ORF Clone, Mouse;PDI-Q2 cDNA ORF Clone, Mouse;PI-PLC cDNA ORF Clone, Mouse;Plca cDNA ORF Clone, Mouse;PLC[a] cDNA ORF Clone, Mouse
PDIA3 Background Information
Full Name
protein disulfide isomerase family A, member 3

PDIA3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PDIA3 cDNA ORF Clone in Cloning Vector, Rat RG80862-U
PDIA3 cDNA ORF Clone, Rat, untagged RG80862-UT
PDIA3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80862-ACGLN
PDIA3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80862-ACG
PDIA3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80862-ACR
PDIA3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80862-CF
PDIA3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80862-NF
PDIA3 cDNA ORF Clone, Rat, C-His tag RG80862-CH
PDIA3 cDNA ORF Clone, Rat, N-His tag RG80862-NH
PDIA3 cDNA ORF Clone, Rat, C-HA tag RG80862-CY
PDIA3 cDNA ORF Clone, Rat, N-HA tag RG80862-NY
PDIA3 cDNA ORF Clone, Rat, C-Myc tag RG80862-CM
PDIA3 cDNA ORF Clone, Rat, N-Myc tag RG80862-NM
PDIA3 qPCR Primer Pairs, Rat RP300826

PDIA3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PDIA3 cDNA ORF Clone in Cloning Vector, Mouse MG51751-G
PDIA3 cDNA ORF Clone, Mouse, untagged MG51751-UT
PDIA3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51751-ACG
PDIA3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51751-ACGLN
PDIA3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51751-ANG
PDIA3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51751-ACR
PDIA3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51751-ANR
PDIA3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51751-CF
PDIA3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51751-NF
PDIA3 cDNA ORF Clone, Mouse, C-His tag MG51751-CH
PDIA3 cDNA ORF Clone, Mouse, N-His tag MG51751-NH
PDIA3 cDNA ORF Clone, Mouse, C-HA tag MG51751-CY
PDIA3 cDNA ORF Clone, Mouse, N-HA tag MG51751-NY
PDIA3 cDNA ORF Clone, Mouse, N-Myc tag MG51751-NM
PDIA3 qPCR Primer Pairs, Mouse MP201624
info info
添加购物车成功! 添加购物车失败!