Quick Order

Mouse PDHA1 / C54G1 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse PDHA1 cDNA Clone Product Information
NCBI RefSeq:NM_008810.2
RefSeq ORF Size:1173bp
cDNA Description:Full length Clone DNA of Mus musculus pyruvate dehydrogenase E1 alpha 1 with C terminal HA tag.
Gene Synonym:Pdha-1
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

PDHA1, also known as C54G1, is an alpha subunit of pyruvate dehydrogenase. Pyruvate dehydrogenase, together with dihydrolipoamide acetyltransferase and lipoamide dehydrogenase, composes the pyruvate dehydrogenase (PDH) complex. The PDH complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. PDHA1 plays a key role in the function of the PDH complex. Defects in PDHA1 can cause pyruvate dehydrogenase E1-alpha deficiency. Defects in PDHA1 also are the cause of X-linked Leigh syndrome (X-LS). X-LS is an early-onset progressive neurodegenerative disorder with a characteristic neuropathology consisting of focal, bilateral lesions in one or more areas of the central nervous system, including the brainstem, thalamus, basal ganglia, cerebellum, and spinal cord.

References
  • Quintana E. et al., 2010, Clin Genet. 77 (5): 474-82.
  • Ah Mew N. et al., 2011, Pediatr Neurol. 45 (1): 57-9.
  • Pinheiro A. et al., 2012, Gene. 506 (1): 173-8.
  • Size / Price
    Catalog: MG51206-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"