Quick Order

Mouse PDHA1 / C54G1 Gene ORF cDNA clone expression plasmid, C-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse PDHA1 cDNA Clone Product Information
    NCBI RefSeq:NM_008810.2
    RefSeq ORF Size:1173bp
    cDNA Description:Full length Clone DNA of Mus musculus pyruvate dehydrogenase E1 alpha 1 with C terminal Flag tag.
    Gene Synonym:Pdha-1
    Species:Mouse
    Vector:pCMV3-C-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PDHA1 qPCR primers for gene expression analysis, MP201090 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    PDHA1, also known as C54G1, is an alpha subunit of pyruvate dehydrogenase. Pyruvate dehydrogenase, together with dihydrolipoamide acetyltransferase and lipoamide dehydrogenase, composes the pyruvate dehydrogenase (PDH) complex. The PDH complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2), and provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle. PDHA1 plays a key role in the function of the PDH complex. Defects in PDHA1 can cause pyruvate dehydrogenase E1-alpha deficiency. Defects in PDHA1 also are the cause of X-linked Leigh syndrome (X-LS). X-LS is an early-onset progressive neurodegenerative disorder with a characteristic neuropathology consisting of focal, bilateral lesions in one or more areas of the central nervous system, including the brainstem, thalamus, basal ganglia, cerebellum, and spinal cord.

    References
  • Quintana E. et al., 2010, Clin Genet. 77 (5): 474-82.
  • Ah Mew N. et al., 2011, Pediatr Neurol. 45 (1): 57-9.
  • Pinheiro A. et al., 2012, Gene. 506 (1): 173-8.
  • Size / Price
    Catalog: MG51206-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"