PDGF-D cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50912-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PDGF-D Reagents
CRO Services
Product recommended

All PDGF-D Reagents
PDGF-D cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1113 bp
Description
Full length Clone DNA of Mouse platelet-derived growth factor, D polypeptide with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDGF-D cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
1110003I09Rik cDNA ORF Clone, Mouse
PDGF-D Background Information

Platelet-derived growth factor D (PDGF-D), also known as Iris-expressed growth factor, is a member of the PDGF/vascular endothelial growth factor family. The four members of this family are mitogenic factors for cells of mesenchymal origin and are characterized by a core motif of eight cysteines, seven of which are found in this factor. PDGF-D/PDGFD only forms homodimers and, therefore, does not dimerize with the other three family members. It differs from alpha and beta members of this family in having an unusual N-terminal domain, the CUB domain. The expression of PDGF-D/PDGFD in the eye is tissue-specific. In the anterior segment, it is localized to iris and ciliary body, whereas in the retina, PDGF-D/PDGFD is restricted to the outer plexiform layer. PDGF-D/PDGFD is present in aqueous humor but is not detectable in mature lens or in mouse lens-derived alphaTN4-1 cells. PDGF-D/PDGFD is highly expressed in human breast cancer and facilitates tumor growth and lymph node metastasis, making it a potential target in breast cancer. PDGF-D/PDGFD increases drug delivery and hence improves the efficacy of chemotherapy through vessel normalization. Intervention in the PDGF-D pathway in the eye, perhaps by antibody or blocking peptide, could be useful in the treatment of certain cataracts, including post-operative secondary cataract.

Full Name
platelet derived growth factor D
References
  • Ray S, et al. (2005) Platelet-derived growth factor D, tissue-specific expression in the eye, and a key role in control of lens epithelial cell proliferation. J Biol Chem. 280(9): 8494-502.
  • Uutela M, et al. (2004) PDGF-D induces macrophage recruitment, increased interstitial pressure, and blood vessel maturation during angiogenesis. Blood. 104 (10): 3198-204.
  • Taneda S, et al. (2004) Obstructive uropathy in mice and humans: potential role for PDGF-D in the progression of tubulointerstitial injury. J Am Soc Nephrol. 14 (10): 2544-55.
  • PDGF-D cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PDGF-D cDNA ORF Clone in Cloning Vector, Mouse MG50912-G
    PDGF-D cDNA ORF Clone, Mouse, untagged MG50912-UT
    PDGF-D Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50912-ACGLN
    PDGF-D cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50912-ACG
    PDGF-D cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50912-ACR
    PDGF-D cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50912-CF
    PDGF-D cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50912-NF
    PDGF-D cDNA ORF Clone, Mouse, C-His tag MG50912-CH
    PDGF-D cDNA ORF Clone, Mouse, N-His tag MG50912-NH
    PDGF-D cDNA ORF Clone, Mouse, C-HA tag MG50912-CY
    PDGF-D cDNA ORF Clone, Mouse, N-HA tag MG50912-NY
    PDGF-D cDNA ORF Clone, Mouse, C-Myc tag MG50912-CM
    PDGF-D qPCR Primer Pairs, Mouse MP200881

    PDGF-D cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PDGF-D cDNA ORF Clone in Cloning Vector, Human HG10281-M
    PDGF-D cDNA ORF Clone in Cloning Vector, Human HG13232-G
    PDGF-D cDNA ORF Clone, Human, untagged HG13232-UT
    PDGF-D cDNA ORF Clone, Human, untagged HG10281-UT
    PDGF-D cDNA ORF Clone, Human, C-GFPSpark® tag HG13232-ACG
    PDGF-D Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13232-ACGLN
    PDGF-D cDNA ORF Clone, Human, C-GFPSpark® tag HG10281-ACG
    PDGF-D Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10281-ACGLN
    PDGF-D cDNA ORF Clone, Human, C-OFPSpark® tag HG10281-ACR
    PDGF-D cDNA ORF Clone, Human, C-OFPSpark® tag HG13232-ACR
    PDGF-D cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10281-CF
    PDGF-D cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13232-CF
    PDGF-D cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13232-NF
    PDGF-D cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10281-NF
    PDGF-D cDNA ORF Clone, Human, C-His tag HG10281-CH
    PDGF-D cDNA ORF Clone, Human, C-His tag HG13232-CH
    PDGF-D cDNA ORF Clone, Human, N-His tag HG13232-NH
    PDGF-D cDNA ORF Clone, Human, N-His tag HG10281-NH
    PDGF-D cDNA ORF Clone, Human, C-HA tag HG13232-CY
    PDGF-D cDNA ORF Clone, Human, C-HA tag HG10281-CY
    PDGF-D cDNA ORF Clone, Human, N-HA tag HG13232-NY
    PDGF-D cDNA ORF Clone, Human, N-HA tag HG10281-NY
    PDGF-D cDNA ORF Clone, Human, C-Myc tag HG13232-CM
    PDGF-D cDNA ORF Clone, Human, C-Myc tag HG10281-CM
    PDGF-D cDNA ORF Clone, Human, N-Myc tag HG10281-NM
    PDGF-D cDNA ORF Clone, Human, N-Myc tag HG13232-NM
    PDGF-D qPCR Primer Pairs, Human HP100327
    info info
    添加购物车成功! 添加购物车失败!