Quick Order

Mouse PDGF-C Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse PDGFC cDNA Clone Product Information
NCBI RefSeq:NM_019971.2
RefSeq ORF Size:1038bp
cDNA Description:Full length Clone DNA of Mus musculus platelet-derived growth factor, C polypeptide with C terminal Myc tag.
Gene Synonym:PDGF-C, AI647969, 1110064L01Rik
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

PDGF-C is a member of the PDGF/VEGF family of growth factors with a unique domain organization and expression pattern. Platelet-derived growth factor receptors (PDGFRs) are catalytic receptors that have intracellular tyrosine kinase activity. They have roles in the regulation of many biological processes including embryonic development, angiogenesis, cell proliferation and differentiation, and contribute to the pathophysiology of some diseases, including cancer. There are two isoforms of the PDGFR receptor; PDGFRalpha and PDGFRbeta, which can form homo- or heterodimers. The endogenous PDGFR ligands are PDGF-A, -B, -C and -D, which induce receptor dimerization and transphosphorylation at specific tyrosine residues upon binding. This activates the intracellular kinase activity, initiating intracellular signaling through the MAPK, PI 3-K and PKCgamma pathways. PDGF-C acts as a specific ligand for alpha platelet-derived growth factor receptor homodimer, and alpha and beta heterodimer. Binding of this growth factor to its affinity receptor elicits a variety of cellular responses. PDGF-C Appears to be involved in the three stages of wound healing: inflammation, proliferation and remodeling. Involved in fibrotic processes, in which transformation of interstitial fibroblasts into myofibroblasts plus collagen deposition occurs.

References
  • Li X, et al. (2000) PDGF-C is a new protease-activated ligand for the PDGF alpha-receptor. Nat Cell Biol. 2 (5): 302-9.
  • Ding H, et al. (2004) A specific requirement for PDGF-C in palate formation and PDGFR-alpha signaling. Nat Genet. 36 (10): 1111-6.
  • Choi SJ, et al. (2009) The PDGF-C regulatory region SNP rs28999109 decreases promoter transcriptional activity and is associated with CL/P. European Journal of Human Genetics. 17 (11): 774-84.
  • Size / Price
    Catalog: MG50458-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"