After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse PDE4B Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Mouse PDE4B cDNA Clone Product Information
NCBI RefSeq:NM_001177980.1
RefSeq ORF Size:1695bp
cDNA Description:Full length Clone DNA of Mus musculus phosphodiesterase 4B, cAMP specific with N terminal Flag tag.
Gene Synonym:Dpde4; dunce; R74983
Species:Mouse
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

cAMP-specific 3',5'-cyclic phosphodiesterase 4B, also known as PDE4B and DPDE4, is a member of the cyclic nucleotide phosphodiesterase family. PDE4 subfamily. Cyclic nucleotide phosphodiesterases (PDEs) comprise a large family of enzymes that catalyze the hydrolysis of cAMP or cGMP and are implicated in various diseases. The crystal structures reveal a common scheme of inhibitor binding to the PDEs: (i) a hydrophobic clamp formed by highly conserved hydrophobic residues that sandwich the inhibitor in the active site; (ii) hydrogen bonding to an invariant glutamine that controls the orientation of inhibitor binding. A scaffold can be readily identified for any given inhibitor based on the formation of these two types of conserved interactions. These structural insights will enable the design of isoform-selective inhibitors with improved binding affinity and should facilitate the discovery of more potent and selective PDE inhibitors for the treatment of a variety of diseases. PDE4B / DPDE4 hydrolyzes the second messenger cAMP, which is a key regulator of many important physiological processes. It is expressed in brain, heart, lung and skeletal muscle. PDE4B / DPDE4 may be involved in mediating central nervous system effects of therapeutic agents ranging from antidepressants to antiasthmatic and anti-inflammatory agents

References
  • Bolger G.et al., 1993, Mol. Cell. Biol. 13:6558-71.
  • Card G.L.et al., 2004, Structure 12:2233-47.
  • Card G.L.et al., 2005, Nat. Biotechnol. 23:201-7.
  • Wang H.et al., 2007, Biochem. J. 408:193-201.
  • Hamblin J.N. et al., 2008, Bioorg. Med. Chem. Lett. 18: 4237-41. 
  • Size / Price
    Catalog: MG51965-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"