PDAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51939-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PDAP1 Reagents
CRO Services
Product recommended

All PDAP1 Reagents
PDAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
546 bp
Description
Full length Clone DNA of Mouse PDGFA associated protein 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
HASPP28 cDNA ORF Clone, Mouse;PAP cDNA ORF Clone, Mouse;PAP1 cDNA ORF Clone, Mouse
PDAP1 Background Information
Full Name
PDGFA associated protein 1

PDAP1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
PDAP1 cDNA ORF Clone in Cloning Vector, Rhesus CG90758-G
PDAP1 cDNA ORF Clone, Rhesus, untagged CG90758-UT
PDAP1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90758-ACGLN
PDAP1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90758-ACG
PDAP1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90758-ANG
PDAP1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90758-ACR
PDAP1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90758-ANR
PDAP1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90758-CF
PDAP1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90758-NF
PDAP1 cDNA ORF Clone, Rhesus, C-His tag CG90758-CH
PDAP1 cDNA ORF Clone, Rhesus, N-His tag CG90758-NH
PDAP1 cDNA ORF Clone, Rhesus, C-HA tag CG90758-CY
PDAP1 cDNA ORF Clone, Rhesus, N-HA tag CG90758-NY
PDAP1 cDNA ORF Clone, Rhesus, C-Myc tag CG90758-CM
PDAP1 cDNA ORF Clone, Rhesus, N-Myc tag CG90758-NM

PDAP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PDAP1 cDNA ORF Clone in Cloning Vector, Mouse MG51939-G
PDAP1 cDNA ORF Clone, Mouse, untagged MG51939-UT
PDAP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51939-ACG
PDAP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51939-ACGLN
PDAP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51939-ANG
PDAP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51939-ACR
PDAP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51939-ANR
PDAP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51939-CF
PDAP1 cDNA ORF Clone, Mouse, C-His tag MG51939-CH
PDAP1 cDNA ORF Clone, Mouse, N-His tag MG51939-NH
PDAP1 cDNA ORF Clone, Mouse, C-HA tag MG51939-CY
PDAP1 cDNA ORF Clone, Mouse, N-HA tag MG51939-NY
PDAP1 cDNA ORF Clone, Mouse, C-Myc tag MG51939-CM
PDAP1 cDNA ORF Clone, Mouse, N-Myc tag MG51939-NM
PDAP1 qPCR Primer Pairs, Mouse MP201812

PDAP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PDAP1 cDNA ORF Clone in Cloning Vector, Human HG14363-G
PDAP1 cDNA ORF Clone, Human, untagged HG14363-UT
PDAP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14363-ACGLN
PDAP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14363-ACG
PDAP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14363-ANG
PDAP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14363-ACR
PDAP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14363-ANR
PDAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14363-CF
PDAP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14363-NF
PDAP1 cDNA ORF Clone, Human, C-His tag HG14363-CH
PDAP1 cDNA ORF Clone, Human, N-His tag HG14363-NH
PDAP1 cDNA ORF Clone, Human, C-HA tag HG14363-CY
PDAP1 cDNA ORF Clone, Human, N-HA tag HG14363-NY
PDAP1 cDNA ORF Clone, Human, C-Myc tag HG14363-CM
PDAP1 cDNA ORF Clone, Human, N-Myc tag HG14363-NM
PDAP1 qPCR Primer Pairs, Human HP103012
info info
添加购物车成功! 添加购物车失败!