PAIP2 cDNA ORF Clone, Mouse, untagged

Cat: MG52489-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All PAIP2 Reagents
CRO Services
Product recommended

All PAIP2 Reagents
PAIP2 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
375 bp
Description
Full length Clone DNA of Mouse polyadenylate-binding protein-interacting protein 2.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PAIP2 cDNA ORF Clone, Mouse, untagged Alternative Names
2310050K10Rik cDNA ORF Clone, Mouse;AU045972 cDNA ORF Clone, Mouse
PAIP2 Background Information
Full Name
poly(A) binding protein interacting protein 2

PAIP2 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
PAIP2 cDNA ORF Clone in Cloning Vector, Canine DG70224-U
PAIP2 cDNA ORF Clone, Canine, untagged DG70224-UT
PAIP2 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70224-ACGLN
PAIP2 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70224-ACG
PAIP2 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70224-ANG
PAIP2 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70224-ACR
PAIP2 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70224-ANR
PAIP2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70224-CF
PAIP2 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70224-NF
PAIP2 cDNA ORF Clone, Canine, C-His tag DG70224-CH
PAIP2 cDNA ORF Clone, Canine, N-His tag DG70224-NH
PAIP2 cDNA ORF Clone, Canine, C-HA tag DG70224-CY
PAIP2 cDNA ORF Clone, Canine, N-HA tag DG70224-NY
PAIP2 cDNA ORF Clone, Canine, C-Myc tag DG70224-CM
PAIP2 cDNA ORF Clone, Canine, N-Myc tag DG70224-NM

PAIP2 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
PAIP2 cDNA ORF Clone in Cloning Vector, Ferret FG60109-G
PAIP2 cDNA ORF Clone, Ferret, untagged FG60109-UT
PAIP2 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60109-ACGLN
PAIP2 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60109-ACG
PAIP2 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60109-ANG
PAIP2 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60109-ACR
PAIP2 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60109-ANR
PAIP2 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60109-CF
PAIP2 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60109-NF
PAIP2 cDNA ORF Clone, Ferret, C-His tag FG60109-CH
PAIP2 cDNA ORF Clone, Ferret, N-His tag FG60109-NH
PAIP2 cDNA ORF Clone, Ferret, C-HA tag FG60109-CY
PAIP2 cDNA ORF Clone, Ferret, N-HA tag FG60109-NY
PAIP2 cDNA ORF Clone, Ferret, C-Myc tag FG60109-CM
PAIP2 cDNA ORF Clone, Ferret, N-Myc tag FG60109-NM

PAIP2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PAIP2 cDNA ORF Clone in Cloning Vector, Rat RG87607-U
PAIP2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87607-ACGLN

PAIP2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PAIP2 cDNA ORF Clone in Cloning Vector, Mouse MG52489-U
PAIP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52489-ACG
PAIP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52489-ACGLN
PAIP2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52489-ANG
PAIP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52489-ACR
PAIP2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52489-ANR
PAIP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52489-CF
PAIP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52489-NF
PAIP2 cDNA ORF Clone, Mouse, C-His tag MG52489-CH
PAIP2 cDNA ORF Clone, Mouse, N-His tag MG52489-NH
PAIP2 cDNA ORF Clone, Mouse, C-HA tag MG52489-CY
PAIP2 cDNA ORF Clone, Mouse, N-HA tag MG52489-NY
PAIP2 cDNA ORF Clone, Mouse, C-Myc tag MG52489-CM
PAIP2 cDNA ORF Clone, Mouse, N-Myc tag MG52489-NM
PAIP2 qPCR Primer Pairs, Mouse MP202362

PAIP2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PAIP2 cDNA ORF Clone in Cloning Vector, Human HG16680-U
PAIP2 cDNA ORF Clone, Human, untagged HG16680-UT
PAIP2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16680-ACGLN
PAIP2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16680-ACG
PAIP2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16680-ANG
PAIP2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16680-ACR
PAIP2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16680-ANR
PAIP2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16680-CF
PAIP2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16680-NF
PAIP2 cDNA ORF Clone, Human, C-His tag HG16680-CH
PAIP2 cDNA ORF Clone, Human, N-His tag HG16680-NH
PAIP2 cDNA ORF Clone, Human, C-HA tag HG16680-CY
PAIP2 cDNA ORF Clone, Human, N-HA tag HG16680-NY
PAIP2 cDNA ORF Clone, Human, C-Myc tag HG16680-CM
PAIP2 cDNA ORF Clone, Human, N-Myc tag HG16680-NM
info info
添加购物车成功! 添加购物车失败!