PABPC1 cDNA ORF Clone, Mouse, C-His tag

Cat: MG52362-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All PABPC1 Reagents
CRO Services
Product recommended

All PABPC1 Reagents
PABPC1 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1911 bp
Description
Full length Clone DNA of Mouse poly(A) binding protein, cytoplasmic 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PABPC1 cDNA ORF Clone, Mouse, C-His tag Alternative Names
ePAB cDNA ORF Clone, Mouse;PABP cDNA ORF Clone, Mouse;Pabp1 cDNA ORF Clone, Mouse;PabpI cDNA ORF Clone, Mouse;Pabpl1 cDNA ORF Clone, Mouse
PABPC1 Background Information
Full Name
poly(A) binding protein, cytoplasmic 1

PABPC1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PABPC1 cDNA ORF Clone in Cloning Vector, Rat RG84882-U
PABPC1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84882-ACGLN

PABPC1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PABPC1 cDNA ORF Clone in Cloning Vector, Mouse MG52362-G
PABPC1 cDNA ORF Clone, Mouse, untagged MG52362-UT
PABPC1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52362-ACGLN
PABPC1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52362-ACG
PABPC1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52362-ANG
PABPC1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52362-ACR
PABPC1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52362-ANR
PABPC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52362-CF
PABPC1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52362-NF
PABPC1 cDNA ORF Clone, Mouse, N-His tag MG52362-NH
PABPC1 cDNA ORF Clone, Mouse, C-HA tag MG52362-CY
PABPC1 cDNA ORF Clone, Mouse, N-HA tag MG52362-NY
PABPC1 cDNA ORF Clone, Mouse, C-Myc tag MG52362-CM
PABPC1 cDNA ORF Clone, Mouse, N-Myc tag MG52362-NM
PABPC1 qPCR Primer Pairs, Mouse MP202235

PABPC1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PABPC1 cDNA ORF Clone in Cloning Vector, Human HG13781-G
PABPC1 cDNA ORF Clone, Human, untagged HG13781-UT
PABPC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13781-ACG
PABPC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13781-ACGLN
PABPC1 cDNA ORF Clone, Human, N-GFPSpark® tag HG13781-ANG
PABPC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13781-ACR
PABPC1 cDNA ORF Clone, Human, N-OFPSpark® tag HG13781-ANR
PABPC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13781-CF
PABPC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13781-NF
PABPC1 cDNA ORF Clone, Human, C-His tag HG13781-CH
PABPC1 cDNA ORF Clone, Human, N-His tag HG13781-NH
PABPC1 cDNA ORF Clone, Human, C-HA tag HG13781-CY
PABPC1 cDNA ORF Clone, Human, N-HA tag HG13781-NY
PABPC1 cDNA ORF Clone, Human, C-Myc tag HG13781-CM
PABPC1 cDNA ORF Clone, Human, N-Myc tag HG13781-NM
PABPC1 qPCR Primer Pairs, Human HP102456
info info
添加购物车成功! 添加购物车失败!