P4HB cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50638-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All P4HB Reagents
CRO Services
Product recommended

All P4HB Reagents
P4HB cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1530 bp
Description
Full length Clone DNA of Mouse prolyl 4-hydroxylase, beta polypeptide with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

P4HB cDNA ORF Clone, Mouse, N-HA tag Alternative Names
ERp59 cDNA ORF Clone, Mouse;PDI cDNA ORF Clone, Mouse;Pdia1 cDNA ORF Clone, Mouse;Thbp cDNA ORF Clone, Mouse
P4HB Background Information

Protein disulfide-isomerase, also known as Cellular thyroid hormone-binding protein, Prolyl 4-hydroxylase subunit beta, p55 and P4HB, is a peripheral membrane protein which belongs to the protein disulfide isomerase family. P4HB is highly abundant. In some cell types, it seems to be also secreted or associated with the plasma membrane, where it undergoes constant shedding and replacement from intracellular sources. P4HB localizes near CD4-enriched regions on lymphoid cell surfaces. It is identified by mass spectrometry in melanosome fractions from stage I to stage IV. P4HB reduces and may activate fusogenic properties of HIV-1 gp120 surface protein, thereby enabling HIV-1 entry into the cell. P4HB catalyzes the formation, breakage and rearrangement of disulfide bonds. At the cell surface, it seems to act as a reductase that cleaves disulfide bonds of proteins attached to the cell. P4HB may therefore cause structural modifications of exofacial proteins. Inside the cell, it seems to form/rearrange disulfide bonds of nascent proteins. At high concentrations, P4HB functions as a chaperone that inhibits aggregation of misfolded proteins. At low concentrations, it facilitates aggregation (anti-chaperone activity). P4HB may be involved with other chaperones in the structural modification of the TG precursor in hormone biogenesis. It also acts a structural subunit of various enzymes such as prolyl 4-hydroxylase and microsomal triacylglycerol transfer protein MTTP.

Full Name
prolyl 4-hydroxylase, beta polypeptide
References
  • Kivirikko KI, et al., 1989, FASEB J., 3 (5): 1609-17.
  • Pihlajaniemi T, et al.,1991, J Hepatol., 13, Suppl 3: S2
  • Fenouillet E., et al., 2001, J. Infect. Dis. 183:744-752.
  • Gevaert K., et al., 2003, Nat. Biotechnol. 21:566-569.
  • Barbouche R., et al., 2003, J. Biol. Chem. 278:3131-3136.
  • P4HB cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    P4HB cDNA ORF Clone in Cloning Vector, Mouse MG50638-M
    P4HB cDNA ORF Clone, Mouse, untagged MG50638-UT
    P4HB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50638-ACG
    P4HB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50638-ACGLN
    P4HB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50638-ACR
    P4HB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50638-CF
    P4HB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50638-NF
    P4HB cDNA ORF Clone, Mouse, C-His tag MG50638-CH
    P4HB cDNA ORF Clone, Mouse, N-His tag MG50638-NH
    P4HB cDNA ORF Clone, Mouse, C-HA tag MG50638-CY
    P4HB cDNA ORF Clone, Mouse, C-Myc tag MG50638-CM
    P4HB cDNA ORF Clone, Mouse, N-Myc tag MG50638-NM
    P4HB qPCR Primer Pairs, Mouse MP200585

    P4HB cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    P4HB cDNA ORF Clone in Cloning Vector, Human HG10827-M
    P4HB cDNA ORF Clone, Human, untagged HG10827-UT
    P4HB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10827-ACGLN
    P4HB cDNA ORF Clone, Human, C-GFPSpark® tag HG10827-ACG
    P4HB cDNA ORF Clone, Human, C-OFPSpark® tag HG10827-ACR
    P4HB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10827-CF
    P4HB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10827-NF
    P4HB cDNA ORF Clone, Human, C-His tag HG10827-CH
    P4HB cDNA ORF Clone, Human, N-His tag HG10827-NH
    P4HB cDNA ORF Clone, Human, C-HA tag HG10827-CY
    P4HB cDNA ORF Clone, Human, N-HA tag HG10827-NY
    P4HB cDNA ORF Clone, Human, C-Myc tag HG10827-CM
    P4HB cDNA ORF Clone, Human, N-Myc tag HG10827-NM
    P4HB qPCR Primer Pairs, Human HP100040
    info info
    添加购物车成功! 添加购物车失败!