After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse P4HB Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse P4HB cDNA Clone Product Information
NCBI RefSeq:NM_011032.2
RefSeq ORF Size:1530bp
cDNA Description:Full length Clone DNA of Mus musculus prolyl 4-hydroxylase, beta polypeptide with C terminal HA tag.
Gene Synonym:PDI, Thbp, ERp59, P4hb
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Mouse protein disulfide-isomerase, also known as Cellular thyroid hormone-binding protein, Prolyl 4-hydroxylase subunit beta, p55 and P4HB, is a peripheral membrane protein which belongs to the protein disulfide isomerase family. P4HB is highly abundant. In some cell types, it seems to be also secreted or associated with the plasma membrane, where it undergoes constant shedding and replacement from intracellular sources. P4HB localizes near CD4-enriched regions on lymphoid cell surfaces. It is identified by mass spectrometry in melanosome fractions from stage I to stage IV. P4HB reduces and may activate fusogenic properties of HIV-1 gp120 surface protein, thereby enabling HIV-1 entry into the cell. P4HB catalyzes the formation, breakage and rearrangement of disulfide bonds. At the cell surface, it seems to act as a reductase that cleaves disulfide bonds of proteins attached to the cell. P4HB may therefore cause structural modifications of exofacial proteins. Inside the cell, it seems to form/rearrange disulfide bonds of nascent proteins. At high concentrations, P4HB functions as a chaperone that inhibits aggregation of misfolded proteins. At low concentrations, it facilitates aggregation (anti-chaperone activity). P4HB may be involved with other chaperones in the structural modification of the TG precursor in hormone biogenesis. It also acts a structural subunit of various enzymes such as prolyl 4-hydroxylase and microsomal triacylglycerol transfer protein MTTP.

References
  • Kivirikko KI, et al., 1989, FASEB J., 3 (5): 1609-17.
  • Pihlajaniemi T, et al.,1991, J Hepatol., 13, Suppl 3: S2
  • Fenouillet E., et al., 2001, J. Infect. Dis. 183:744-752.
  • Gevaert K., et al., 2003, Nat. Biotechnol. 21:566-569.
  • Barbouche R., et al., 2003, J. Biol. Chem. 278:3131-3136.
  • Size / Price
    Catalog: MG50638-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"