OXSR1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50886-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All OXSR1 Reagents
CRO Services
Product recommended

All OXSR1 Reagents
OXSR1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1416 bp
Description
Full length Clone DNA of Mouse oxidative-stress responsive 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

OXSR1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
2210022N24Rik cDNA ORF Clone, Mouse;2810422B09Rik cDNA ORF Clone, Mouse;AI462649 cDNA ORF Clone, Mouse;AW209236 cDNA ORF Clone, Mouse;mKIAA1101 cDNA ORF Clone, Mouse;Osr1 cDNA ORF Clone, Mouse
OXSR1 Background Information

Oxidative stress-responsive 1 protein (OXSR1), also known as Serine/threonine-protein kinase OSR1, is a member of the Ser/Thr protein kinase family of proteins. OXSR1 regulates downstream kinases in response to environmental stress, and may play a role in regulating the actin cytoskeleton. OXSR1 is a 58 kDa protein of 527 amino acids that is widely expressed in mammalian tissues and cell lines. The amino acid (aa) sequence of the predicted OXSR1 protein is 39% identical to that of human SOK1. Of potential regulators surveyed, endogenous OXSR1 is activated only by osmotic stresses, notably sorbitol and to a lesser extent NaCl. OXSR1 did not increase the activity of coexpressed JNK, nor did it activate three other MAPKs, p38, ERK2, and ERK5. Phosphorylation by OXSR1 modulates the G protein sensitivity of PAK isoforms. The OXSR1 and SPAK are key enzymes in a signalling cascade regulating the activity of Na+/K+/2Cl- co-transporters (NKCCs) in response to osmotic stress. Both kinases have a conserved carboxy-terminal (CCT) domain, which recognizes a unique peptide (Arg-Phe-Xaa-Val) motif. The OXSR1 and SPAK kinases specifically recognize their upstream activators and downstream substrates.

Full Name
oxidative stress responsive 1
References
  • Tamari M., et al.,(1999), Isolation and characterization of a novel serine threonine kinase gene on chromosome 3p22-21.3. J. Hum. Genet. 44:116-120.
  • Kikuno R., et al., (1999), Prediction of the coding sequences of unidentified human genes. XIV. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro.DNA Res. 6:197-205.
  • Chen W., et al.,(2004), Characterization of OSR1, a member of the mammalian Ste20p/germinal center kinase subfamily.J. Biol. Chem. 279:11129-11136.
  • OXSR1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    OXSR1 cDNA ORF Clone in Cloning Vector, Mouse MG50886-G
    OXSR1 cDNA ORF Clone, Mouse, untagged MG50886-UT
    OXSR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50886-ACGLN
    OXSR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50886-ACG
    OXSR1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50886-ANG
    OXSR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50886-ACR
    OXSR1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50886-ANR
    OXSR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50886-CF
    OXSR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50886-NF
    OXSR1 cDNA ORF Clone, Mouse, C-His tag MG50886-CH
    OXSR1 cDNA ORF Clone, Mouse, C-HA tag MG50886-CY
    OXSR1 cDNA ORF Clone, Mouse, N-HA tag MG50886-NY
    OXSR1 cDNA ORF Clone, Mouse, C-Myc tag MG50886-CM
    OXSR1 cDNA ORF Clone, Mouse, N-Myc tag MG50886-NM
    OXSR1 qPCR Primer Pairs, Mouse MP200857

    OXSR1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    OXSR1 cDNA ORF Clone in Cloning Vector, Human HG10727-M
    OXSR1 cDNA ORF Clone, Human, untagged HG10727-UT
    OXSR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10727-ACG
    OXSR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10727-ACGLN
    OXSR1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10727-ANG
    OXSR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10727-ACR
    OXSR1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10727-ANR
    OXSR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10727-CF
    OXSR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10727-NF
    OXSR1 cDNA ORF Clone, Human, C-His tag HG10727-CH
    OXSR1 cDNA ORF Clone, Human, N-His tag HG10727-NH
    OXSR1 cDNA ORF Clone, Human, C-HA tag HG10727-CY
    OXSR1 cDNA ORF Clone, Human, N-HA tag HG10727-NY
    OXSR1 cDNA ORF Clone, Human, C-Myc tag HG10727-CM
    OXSR1 cDNA ORF Clone, Human, N-Myc tag HG10727-NM
    OXSR1 qPCR Primer Pairs, Human HP100665
    info info
    添加购物车成功! 添加购物车失败!