OXCT1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52069-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All OXCT1 Reagents
CRO Services
Product recommended

All OXCT1 Reagents
OXCT1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1623 bp
Description
Full length Clone DNA of Mouse 3-oxoacid CoA transferase 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

OXCT1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
2610008O03Rik cDNA ORF Clone, Mouse;Oxct cDNA ORF Clone, Mouse;Oxct2a cDNA ORF Clone, Mouse;Scot-s cDNA ORF Clone, Mouse
OXCT1 Background Information
Full Name
3-oxoacid CoA transferase 1

OXCT1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
OXCT1 cDNA ORF Clone in Cloning Vector, Rat RG81481-G

OXCT1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
OXCT1 cDNA ORF Clone in Cloning Vector, Mouse MG52069-G
OXCT1 cDNA ORF Clone, Mouse, untagged MG52069-UT
OXCT1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52069-ACGLN
OXCT1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52069-ACG
OXCT1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52069-ANG
OXCT1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52069-ACR
OXCT1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52069-ANR
OXCT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52069-CF
OXCT1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52069-NF
OXCT1 cDNA ORF Clone, Mouse, C-His tag MG52069-CH
OXCT1 cDNA ORF Clone, Mouse, N-His tag MG52069-NH
OXCT1 cDNA ORF Clone, Mouse, C-HA tag MG52069-CY
OXCT1 cDNA ORF Clone, Mouse, N-HA tag MG52069-NY
OXCT1 cDNA ORF Clone, Mouse, C-Myc tag MG52069-CM
OXCT1 qPCR Primer Pairs, Mouse MP201942

OXCT1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
OXCT1 cDNA ORF Clone in Cloning Vector, Human HG15008-G
OXCT1 cDNA ORF Clone, Human, untagged HG15008-UT
OXCT1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15008-ACGLN
OXCT1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15008-ACG
OXCT1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15008-ANG
OXCT1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15008-ACR
OXCT1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15008-ANR
OXCT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15008-CF
OXCT1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15008-NF
OXCT1 cDNA ORF Clone, Human, C-His tag HG15008-CH
OXCT1 cDNA ORF Clone, Human, N-His tag HG15008-NH
OXCT1 cDNA ORF Clone, Human, C-HA tag HG15008-CY
OXCT1 cDNA ORF Clone, Human, N-HA tag HG15008-NY
OXCT1 cDNA ORF Clone, Human, C-Myc tag HG15008-CM
OXCT1 cDNA ORF Clone, Human, N-Myc tag HG15008-NM
OXCT1 qPCR Primer Pairs, Human HP103636
info info
添加购物车成功! 添加购物车失败!