ORC4 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52192-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ORC4 Reagents
CRO Services
Product recommended

All ORC4 Reagents
ORC4 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1302 bp
Description
Full length Clone DNA of Mouse origin recognition complex, subunit 4 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ORC4 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
mMmORC4 cDNA ORF Clone, Mouse;Orc4l cDNA ORF Clone, Mouse;Orc4P cDNA ORF Clone, Mouse
ORC4 Background Information
Full Name
origin recognition complex, subunit 4

ORC4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ORC4 cDNA ORF Clone in Cloning Vector, Mouse MG52192-G
ORC4 cDNA ORF Clone, Mouse, untagged MG52192-UT
ORC4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52192-ACG
ORC4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52192-ACGLN
ORC4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52192-ANG
ORC4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52192-ACR
ORC4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52192-ANR
ORC4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52192-CF
ORC4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52192-NF
ORC4 cDNA ORF Clone, Mouse, C-His tag MG52192-CH
ORC4 cDNA ORF Clone, Mouse, N-His tag MG52192-NH
ORC4 cDNA ORF Clone, Mouse, C-HA tag MG52192-CY
ORC4 cDNA ORF Clone, Mouse, C-Myc tag MG52192-CM
ORC4 cDNA ORF Clone, Mouse, N-Myc tag MG52192-NM
ORC4 qPCR Primer Pairs, Mouse MP202065

ORC4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ORC4 cDNA ORF Clone in Cloning Vector, Human HG19596-U
ORC4 cDNA ORF Clone, Human, untagged HG19596-UT
ORC4 cDNA ORF Clone, Human, C-GFPSpark® tag HG19596-ACG
ORC4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19596-ACGLN
ORC4 cDNA ORF Clone, Human, N-GFPSpark® tag HG19596-ANG
ORC4 cDNA ORF Clone, Human, C-OFPSpark® tag HG19596-ACR
ORC4 cDNA ORF Clone, Human, N-OFPSpark® tag HG19596-ANR
ORC4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG19596-CF
ORC4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG19596-NF
ORC4 cDNA ORF Clone, Human, C-His tag HG19596-CH
ORC4 cDNA ORF Clone, Human, N-His tag HG19596-NH
ORC4 cDNA ORF Clone, Human, C-HA tag HG19596-CY
ORC4 cDNA ORF Clone, Human, N-HA tag HG19596-NY
ORC4 cDNA ORF Clone, Human, C-Myc tag HG19596-CM
ORC4 cDNA ORF Clone, Human, N-Myc tag HG19596-NM
info info
添加购物车成功! 添加购物车失败!