After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse NXT2 cDNA Clone Product Information
NCBI RefSeq:NM_001037756.2
RefSeq ORF Size:429 bp
cDNA Description:Full length Clone DNA of Mus musculus nuclear transport factor 2-like export factor 2
Gene Synonym:6330587F24Rik,AI787442,P15-2
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid on other vectors
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG51629-ACG$225
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG51629-ACR$225
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG51629-ANG$225
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG51629-ANR$225
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, C-Flag tagMG51629-CF$75
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, C-His tagMG51629-CH$195
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, C-Myc tagMG51629-CM$195
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, C-HA tagMG51629-CY$195
Mouse NXT2 Gene cDNA clone plasmidMG51629-G$75
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, N-Flag tagMG51629-NF$195
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, N-His tagMG51629-NH$195
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, N-Myc tagMG51629-NM$195
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, N-HA tagMG51629-NY$195
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone in cloning vectorMG51629-U$75
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmidMG51629-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: MG51629-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"