Quick Order

Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse NXT2 cDNA Clone Product Information
NCBI RefSeq:NM_001037756.2
RefSeq ORF Size:429 bp
cDNA Description:Full length Clone DNA of Mus musculus nuclear transport factor 2-like export factor 2
Gene Synonym:6330587F24Rik,AI787442,P15-2
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, C-Myc tag on other vectors
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG51629-ACG$225
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG51629-ACR$225
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG51629-ANG$225
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG51629-ANR$225
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, C-Flag tagMG51629-CF$75
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, C-His tagMG51629-CH$195
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, C-Myc tagMG51629-CM$195
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, C-HA tagMG51629-CY$195
Mouse NXT2 Gene cDNA clone plasmidMG51629-G$75
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, N-Flag tagMG51629-NF$195
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, N-His tagMG51629-NH$195
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, N-Myc tagMG51629-NM$195
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmid, N-HA tagMG51629-NY$195
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone in cloning vectorMG51629-U$75
Mouse NXT2/NTF2-related export protein 2 Gene ORF cDNA clone expression plasmidMG51629-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: MG51629-CM
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"