NUP62 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52994-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NUP62 Reagents
CRO Services
Product recommended

All NUP62 Reagents
NUP62 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1581 bp
Description
Full length Clone DNA of Mouse nucleoporin 62 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NUP62 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
AA589433 cDNA ORF Clone, Mouse;AI426861 cDNA ORF Clone, Mouse;AI790512 cDNA ORF Clone, Mouse;AU045898 cDNA ORF Clone, Mouse;D7Ertd649e cDNA ORF Clone, Mouse;Nupc1 cDNA ORF Clone, Mouse;p62 cDNA ORF Clone, Mouse
NUP62 Background Information
Full Name
nucleoporin 62kDa

NUP62 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NUP62 cDNA ORF Clone in Cloning Vector, Rat RG80827-U
NUP62 cDNA ORF Clone, Rat, untagged RG80827-UT
NUP62 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80827-ACGLN
NUP62 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80827-ACG
NUP62 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80827-ANG
NUP62 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80827-ACR
NUP62 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80827-ANR
NUP62 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80827-CF
NUP62 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80827-NF
NUP62 cDNA ORF Clone, Rat, C-His tag RG80827-CH
NUP62 cDNA ORF Clone, Rat, N-His tag RG80827-NH
NUP62 cDNA ORF Clone, Rat, C-HA tag RG80827-CY
NUP62 cDNA ORF Clone, Rat, N-HA tag RG80827-NY
NUP62 cDNA ORF Clone, Rat, C-Myc tag RG80827-CM
NUP62 cDNA ORF Clone, Rat, N-Myc tag RG80827-NM
NUP62 qPCR Primer Pairs, Rat RP300791

NUP62 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NUP62 cDNA ORF Clone in Cloning Vector, Mouse MG52994-G
NUP62 cDNA ORF Clone, Mouse, untagged MG52994-UT
NUP62 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52994-ACGLN
NUP62 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52994-ACG
NUP62 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52994-ANG
NUP62 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52994-ACR
NUP62 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52994-ANR
NUP62 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52994-CF
NUP62 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52994-NF
NUP62 cDNA ORF Clone, Mouse, C-His tag MG52994-CH
NUP62 cDNA ORF Clone, Mouse, N-His tag MG52994-NH
NUP62 cDNA ORF Clone, Mouse, C-HA tag MG52994-CY
NUP62 cDNA ORF Clone, Mouse, N-HA tag MG52994-NY
NUP62 cDNA ORF Clone, Mouse, N-Myc tag MG52994-NM

NUP62 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NUP62 cDNA ORF Clone in Cloning Vector, Human HG18517-U
NUP62 cDNA ORF Clone, Human, untagged HG18517-UT
NUP62 cDNA ORF Clone, Human, C-GFPSpark® tag HG18517-ACG
NUP62 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18517-ACGLN
NUP62 cDNA ORF Clone, Human, N-GFPSpark® tag HG18517-ANG
NUP62 cDNA ORF Clone, Human, C-OFPSpark® tag HG18517-ACR
NUP62 cDNA ORF Clone, Human, N-OFPSpark® tag HG18517-ANR
NUP62 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18517-CF
NUP62 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18517-NF
NUP62 cDNA ORF Clone, Human, C-His tag HG18517-CH
NUP62 cDNA ORF Clone, Human, N-His tag HG18517-NH
NUP62 cDNA ORF Clone, Human, C-HA tag HG18517-CY
NUP62 cDNA ORF Clone, Human, N-HA tag HG18517-NY
NUP62 cDNA ORF Clone, Human, C-Myc tag HG18517-CM
NUP62 cDNA ORF Clone, Human, N-Myc tag HG18517-NM
info info
添加购物车成功! 添加购物车失败!