NUCB1/Nucleobindin 1 cDNA ORF Clone, Mouse, untagged

Price:
Size:
Number:

NUCB1/Nucleobindin 1 cDNA ORF Clone, Mouse, untagged: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1380 bp
Description
Full length Clone DNA of Mouse nucleobindin 1.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

NUCB1/Nucleobindin 1 cDNA ORF Clone, Mouse, untagged: Alternative Names

B230337F23Rik cDNA ORF Clone, Mouse; C77483 cDNA ORF Clone, Mouse; Calnuc cDNA ORF Clone, Mouse; MTEST82 cDNA ORF Clone, Mouse; Nucb cDNA ORF Clone, Mouse

NUCB1/Nucleobindin 1 Background Information

NUCB1/Nucleobindin 1 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait