After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse TrkA/NTRK1 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse NTRK1 cDNA Clone Product Information
NCBI RefSeq:NM_001033124.1
RefSeq ORF Size:2400bp
cDNA Description:Full length Clone DNA of Mus musculus neurotrophic tyrosine kinase, receptor, type 1 with C terminal His tag.
Gene Synonym:Tkr, trk, TrkA, C80751, Ntrk1
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

TRKA is a member of the neurotrophic tyrosine kinase receptor (NTKR) family. It is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Isoform TrkA-III promotes angiogenesis and has oncogenic activity when overexpressed. Isoform TrkA-I is found in most non-neuronal tissues. Isoform TrkA-II is primarily expressed in neuronal cells. TrkA-III is specifically expressed by pluripotent neural stem and neural crest progenitors. The presence of NTRK1 leads to cell differentiation and may play a role in specifying sensory neuron subtypes. Mutations in TRKA gene have been associated with congenital insensitivity to pain, anhidrosis, self-mutilating behavior, mental retardation and cancer. It was originally identified as an oncogene as it is commonly mutated in cancers, particularly colon and thyroid carcinomas. TRKA is required for high-affinity binding to nerve growth factor (NGF), neurotrophin-3 and neurotrophin-4/5 but not brain-derived neurotrophic factor (BDNF). Known substrates for the Trk receptors are SHC1, PI 3-kinase, and PLC-gamma-1. NTRK1 has a crucial role in the development and function of the nociceptive reception system as well as establishment of thermal regulation via sweating. It also activates ERK1 by either SHC1- or PLC-gamma-1-dependent signaling pathway. Defects in NTRK1 are a cause of congenital insensitivity to pain with anhidrosis and thyroid papillary carcinoma.

References
  • Lambiase A, et al. (2005) Molecular basis for keratoconus: lack of TrkA expression and its transcriptional repression by Sp3. Natl Acad Sci. 102 (46):16795-800.
  • Benito-Gutiérrez E, et al. (2006) Origin and evolution of the Trk family of neurotrophic receptors. Mol Cell Neurosci. 31(2):179-92.
  • Martin-Zanca D, et al. (1986) A human oncogene formed by the fusion of truncated tropomyosin and protein tyrosine kinase sequences. Nature. 319(6056):743-8.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"