NSG2/neuron specific gene family member 2 cDNA ORF Clone, Mouse, C-His tag

Cat: MG51251-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NSG2/neuron specific gene family member 2 Reagents
CRO Services
Product recommended

All NSG2/neuron specific gene family member 2 Reagents
NSG2/neuron specific gene family member 2 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
516 bp
Description
Full length Clone DNA of Mouse neuron specific gene family member 2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NSG2/neuron specific gene family member 2 Background Information
Full Name
neuron specific gene family member 2

NSG2/neuron specific gene family member 2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NSG2/neuron specific gene family member 2 cDNA ORF Clone in Cloning Vector, Rat RG8A0670-U
NSG2/neuron specific gene family member 2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0670-ACGLN

NSG2/neuron specific gene family member 2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NSG2/neuron specific gene family member 2 cDNA ORF Clone in Cloning Vector, Mouse MG51251-U
NSG2/neuron specific gene family member 2 cDNA ORF Clone, Mouse, untagged MG51251-UT
NSG2/neuron specific gene family member 2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51251-ACG
NSG2/neuron specific gene family member 2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51251-ACGLN
NSG2/neuron specific gene family member 2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51251-ACR
NSG2/neuron specific gene family member 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51251-CF
NSG2/neuron specific gene family member 2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51251-NF
NSG2/neuron specific gene family member 2 cDNA ORF Clone, Mouse, N-His tag MG51251-NH
NSG2/neuron specific gene family member 2 cDNA ORF Clone, Mouse, C-HA tag MG51251-CY
NSG2/neuron specific gene family member 2 cDNA ORF Clone, Mouse, N-HA tag MG51251-NY
NSG2/neuron specific gene family member 2 cDNA ORF Clone, Mouse, C-Myc tag MG51251-CM
NSG2/neuron specific gene family member 2 cDNA ORF Clone, Mouse, N-Myc tag MG51251-NM
NSG2/neuron specific gene family member 2 qPCR Primer Pairs, Mouse MP201133
info info
添加购物车成功! 添加购物车失败!