NRN1 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52152-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NRN1 Reagents
CRO Services
Product recommended

All NRN1 Reagents
NRN1 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
429 bp
Description
Full length Clone DNA of Mouse neuritin 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NRN1 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
0710008J23Rik cDNA ORF Clone, Mouse;Cpg15 cDNA ORF Clone, Mouse;Nrn cDNA ORF Clone, Mouse
NRN1 Background Information

Neuritin 1 (NRN1) is a member of neuritin family. Neuritin is a glycosylphosphatidylinositol- anchored protein induced by neural activity. It is expressed in postmitotic-differentiating neurons of the developing nervous system and a population of small-diameter neurons in the dorsal root ganglia and was anterogradely and retrogradely transported. Neuritin message is induced by neuronal activity and by the activity-regulated neurotrophins BDNF, nerve growth factor (NGF) and NT-3. Purified recombinant neuritin promotes neurite outgrowth and arborization in primary embryonic hippocampal and cortical cultures. Thus, neuritin is considered as a downstream effector of activity-induced neurite outgrowth. In clinical, neuritin levels in diabetes were reduced in both dorsal root ganglia and sciatic nerve of rats, and these deficits were reversed in vivo by treatment with NGF. This manipulation of neuritin levels in diabetes may provide a potential target for the therapeutic intervention in the management of neuropathy.

Full Name
neuritin 1
References
  • Karamoysoyli E, et al. (2008) Neuritin mediates nerve growth factor-induced axonal regeneration and is deficient in experimental diabetic neuropathy. Diabetes. 57(1): 181-9.
  • Naeve GS, et al. (1997) Neuritin: A gene induced by neural activity and neurotrophins that promotes neuritogenesis. Proc Natl Acad Sci U S A. 94(6): 2648-2653.
  • Kojima N, et al. (2005) Expression of neuritin during liver maturation and regeneration. FEBS Lett. 579(21): 4562-6.
  • info info
    添加购物车成功! 添加购物车失败!