Quick Order

Mouse NOG / Noggin ORF mammalian expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse NOG cDNA Clone Product Information
NCBI RefSeq:NM_008711.2
RefSeq ORF Size:699bp
cDNA Description:Full length Clone DNA of Mus musculus Noggin with N terminal HA tag.
Gene Synonym:Nog
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:pCMV3-HA-mNOG
Restriction Site:KpnI + XbaI (6kb + 0.7kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 130 C/T, 243 T/C, 255 T/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse NOG Gene Plasmid Map
Mouse NOG / Noggin natural ORF mammalian expression plasmid, N-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Noggin is a secreted protein involved at multiple stages of vertebrate embryonic development including neural induction and is known to exert its effects by inhibiting the bone morphogenetic protein (BMP)-signaling pathway. It binds several BMPs with very high (picomolar) affinities, with a marked preference for BMP2 and BMP4 over BMP7. By binding tightly to BMPs, Noggin prevents BMPs from binding their receptors. Noggin binds the bone morphogenetic proteins (BMP) such as BMP-4 and BMP-7, and inhibits BMP signaling by blocking the molecular interfaces of the binding epitopes for both type I and type II receptors. Interaction of BMP and its antagonist Noggin governs various developmental and cellular processes, including embryonic dorsal-ventral axis, induction of neural tissue, formation of joints in the skeletal system and neurogenesis in the adult brain. Noggin plays a key role in neural induction by inhibiting BMP4, along with other TGF-β signaling inhibitors such as chordin and follistatin. Mouse knockout experiments have demonstrated that noggin also plays a crucial role in bone development, joint formation, and neural tube fusion.

References
  • Zimmerman LB, et al. (1996) The Spemann organizer signal noggin binds and inactivates bone morphogenetic protein 4. Cell. 86(4): 599-606.
  • Chandramore K, et al. (2010) Cloning of noggin gene from hydra and analysis of its functional conservation using Xenopus laevis embryos. Evol Dev. 12(3): 267-74.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"