NME1 cDNA ORF Clone, Mouse, untagged

Cat: MG51576-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NME1 Reagents
CRO Services
Product recommended

All NME1 Reagents
NME1 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
459 bp
Description
Full length Clone DNA of Mouse NME/NM23 nucleoside diphosphate kinase 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NME1 cDNA ORF Clone, Mouse, untagged Alternative Names
AL024257 cDNA ORF Clone, Mouse;NDPK-A cDNA ORF Clone, Mouse;NM23-M1 cDNA ORF Clone, Mouse;NM23A cDNA ORF Clone, Mouse
NME1 Background Information

NME1, also known as Nucleoside Diphosphate Kinase A (NDK-A), or NM23-H1, belongs to the NDK family. NM23-H1 is known to have a metastasis suppressive activity in many tumor cells. Recent studies have shown that the interacting proteins with NM23-H1 which mediate the cell proliferation, may act as modulators of the metastasis suppressor activity. The interacting proteins with NM23-H1 can be classified into 3 groups. The first group of proteins can be classified as upstream kinases of NM23-H1 such as CKI and Aurora-A/STK15. The second group of proteins acts as downstream effectors for the regulation of specific gene transcriptions, GTP-binding protein functions, and signal transduction in Erk signal cascade. The third group of proteins can be classified as bi-directionally influencing binding partners of NM23-H1. As a result, the interactions with NM23-H1 and binding partners have implications in the biochemical characterization involved in metastasis and tumorigenesis. NDKA is increased in human postmortem cerebrospinal fluid (CSF), a model of global brain insult, suggesting that measurement in CSF and, more importantly, in plasma may be useful as a biomarker of stroke. Additionally, NM23-H1 significantly reduces metastasis without effects on primary tumor size and was the first discovered metastasis suppressor gene.

Full Name
NME/NM23 nucleoside diphosphate kinase 1
References
  • Allard L, et al. (2005) PARK7 and nucleoside diphosphate kinase A as plasma markers for the early diagnosis of stroke. Clin Chem. 51(11): 2043-51.
  • Steeg PS, et al. (2008) Clinical-translational approaches to the Nm23-H1 metastasis suppressor. Clin Cancer Res. 14(16): 5006-12.
  • Kim HD, et al. (2009) Regulators affecting the metastasis suppressor activity of Nm23-H1. Mol Cell Biochem. 329(1-2): 167-73.
  • NME1 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    NME1 cDNA ORF Clone in Cloning Vector, Canine DG70213-U
    NME1 cDNA ORF Clone, Canine, untagged DG70213-UT
    NME1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70213-ACGLN
    NME1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70213-ACG
    NME1 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70213-ANG
    NME1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70213-ACR
    NME1 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70213-ANR
    NME1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70213-CF
    NME1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70213-NF
    NME1 cDNA ORF Clone, Canine, C-His tag DG70213-CH
    NME1 cDNA ORF Clone, Canine, N-His tag DG70213-NH
    NME1 cDNA ORF Clone, Canine, C-HA tag DG70213-CY
    NME1 cDNA ORF Clone, Canine, N-HA tag DG70213-NY
    NME1 cDNA ORF Clone, Canine, C-Myc tag DG70213-CM
    NME1 cDNA ORF Clone, Canine, N-Myc tag DG70213-NM

    NME1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    NME1 cDNA ORF Clone in Cloning Vector, Mouse MG51576-G
    NME1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51576-ACG
    NME1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51576-ACGLN
    NME1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51576-ANG
    NME1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51576-ACR
    NME1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51576-ANR
    NME1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51576-CF
    NME1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51576-NF
    NME1 cDNA ORF Clone, Mouse, C-His tag MG51576-CH
    NME1 cDNA ORF Clone, Mouse, N-His tag MG51576-NH
    NME1 cDNA ORF Clone, Mouse, C-HA tag MG51576-CY
    NME1 cDNA ORF Clone, Mouse, N-HA tag MG51576-NY
    NME1 cDNA ORF Clone, Mouse, C-Myc tag MG51576-CM
    NME1 cDNA ORF Clone, Mouse, N-Myc tag MG51576-NM
    NME1 qPCR Primer Pairs, Mouse MP201459

    NME1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    NME1 cDNA ORF Clone in Cloning Vector, Human HG11615-M
    NME1 cDNA ORF Clone, Human, untagged HG11615-UT
    NME1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11615-ACG
    NME1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11615-ACGLN
    NME1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11615-ANG
    NME1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11615-ACR
    NME1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11615-ANR
    NME1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11615-CF
    NME1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11615-NF
    NME1 cDNA ORF Clone, Human, C-His tag HG11615-CH
    NME1 cDNA ORF Clone, Human, N-His tag HG11615-NH
    NME1 cDNA ORF Clone, Human, C-HA tag HG11615-CY
    NME1 cDNA ORF Clone, Human, N-HA tag HG11615-NY
    NME1 cDNA ORF Clone, Human, C-Myc tag HG11615-CM
    NME1 cDNA ORF Clone, Human, N-Myc tag HG11615-NM
    NME1 qPCR Primer Pairs, Human HP100021
    info info
    添加购物车成功! 添加购物车失败!