NIPSNAP1 cDNA ORF Clone, Mouse, C-His tag

Cat: MG52374-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NIPSNAP1 Reagents
CRO Services
Product recommended

All NIPSNAP1 Reagents
NIPSNAP1 cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
855 bp
Description
Full length Clone DNA of Mouse 4-nitrophenylphosphatase domain and non-neuronal SNAP25-like protein homolog 1 (C. elegans) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NIPSNAP1 Background Information
Full Name
nipsnap homolog 1 (C. elegans)

NIPSNAP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NIPSNAP1 cDNA ORF Clone in Cloning Vector, Mouse MG52374-G
NIPSNAP1 cDNA ORF Clone, Mouse, untagged MG52374-UT
NIPSNAP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52374-ACG
NIPSNAP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52374-ACGLN
NIPSNAP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52374-ANG
NIPSNAP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52374-ACR
NIPSNAP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52374-ANR
NIPSNAP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52374-CF
NIPSNAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52374-NF
NIPSNAP1 cDNA ORF Clone, Mouse, N-His tag MG52374-NH
NIPSNAP1 cDNA ORF Clone, Mouse, C-HA tag MG52374-CY
NIPSNAP1 cDNA ORF Clone, Mouse, N-HA tag MG52374-NY
NIPSNAP1 cDNA ORF Clone, Mouse, C-Myc tag MG52374-CM
NIPSNAP1 cDNA ORF Clone, Mouse, N-Myc tag MG52374-NM
NIPSNAP1 qPCR Primer Pairs, Mouse MP202247

NIPSNAP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NIPSNAP1 cDNA ORF Clone in Cloning Vector, Human HG16621-U
NIPSNAP1 cDNA ORF Clone, Human, untagged HG16621-UT
NIPSNAP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16621-ACGLN
NIPSNAP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16621-ACG
NIPSNAP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16621-ANG
NIPSNAP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16621-ACR
NIPSNAP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16621-ANR
NIPSNAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16621-CF
NIPSNAP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16621-NF
NIPSNAP1 cDNA ORF Clone, Human, C-His tag HG16621-CH
NIPSNAP1 cDNA ORF Clone, Human, N-His tag HG16621-NH
NIPSNAP1 cDNA ORF Clone, Human, C-HA tag HG16621-CY
NIPSNAP1 cDNA ORF Clone, Human, N-HA tag HG16621-NY
NIPSNAP1 cDNA ORF Clone, Human, C-Myc tag HG16621-CM
NIPSNAP1 cDNA ORF Clone, Human, N-Myc tag HG16621-NM
info info
添加购物车成功! 添加购物车失败!