NEGR1 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50601-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NEGR1 Reagents
CRO Services
Product recommended

All NEGR1 Reagents
NEGR1 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1047 bp
Description
Full length Clone DNA of Mouse neuronal growth regulator 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NEGR1 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
5330422G01Rik cDNA ORF Clone, Mouse;KILON cDNA ORF Clone, Mouse;Ntra cDNA ORF Clone, Mouse
NEGR1 Background Information

Neuronal Growth Regulator 1, NEGR1, also known as neurotractin, or KILON, which belongs to the immunoglobulin superfamily, IgLON family. This GPI-linked cell surface glycoprotein NEGR1 is composed of three Ig-like domains and belongs to the IgLON subgroup of neural IgSF members. It is expressed in two isoforms with apparent molecular masses of 50 and 37 kD, termed L-form and S-form, respectively. NEGR1/Neurotractin participates in the regulation of neurite outgrowth in the developing brain, and is expressed on neurites of primary hippocampal neurons. Neurotractin/KILON is a trans-neural growth-promoting factor for outgrowing axons following hippocampal denervation. KILON (kindred of IgLON) and opioid-binding cell adhesion molecule belong to the IgLON subgroup of immunoglobulin superfamily together with the limbic system-associated membrane protein and neurotrimin. The alteration of modulatory function of KILON/NEGR1 for the number of dendritic synapses concomitant with changes in its localization and detergent solubility during neuronal culture development. In addition to its reported role in the brain, NEGR1 is also expressed in subcutaneous adipose tissue and acts as a central 'hub' in an obesity-related transcript network.

Full Name
neuronal growth regulator 1
References
  • Marg A, et al. (1999) Neurotractin, a novel neurite outgrowth-promoting Ig-like protein that interacts with CEPU-1 and LAMP. J Cell Biol. 145(4): 865-76.
  • Miyata S, et al. (2003) Biochemical and ultrastructural analyses of IgLON cell adhesion molecules, Kilon and OBCAM in the rat brain. Neuroscience. 117(3): 645-58.
  • Schfer M, et al. (2005) Neurotractin/kilon promotes neurite outgrowth and is expressed on reactive astrocytes after entorhinal cortex lesion. Mol Cell Neurosci. 29(4): 580-90.
  • Hashimoto T, et al. (2008) IgLON cell adhesion molecule Kilon is a crucial modulator for synapse number in hippocampal neurons. Brain Res. 1224: 1-11.
  • NEGR1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    NEGR1 cDNA ORF Clone in Cloning Vector, Mouse MG50601-M
    NEGR1 cDNA ORF Clone, Mouse, untagged MG50601-UT
    NEGR1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50601-ACG
    NEGR1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50601-ACGLN
    NEGR1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50601-ACR
    NEGR1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50601-CF
    NEGR1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50601-NF
    NEGR1 cDNA ORF Clone, Mouse, C-His tag MG50601-CH
    NEGR1 cDNA ORF Clone, Mouse, N-His tag MG50601-NH
    NEGR1 cDNA ORF Clone, Mouse, C-HA tag MG50601-CY
    NEGR1 cDNA ORF Clone, Mouse, C-Myc tag MG50601-CM
    NEGR1 cDNA ORF Clone, Mouse, N-Myc tag MG50601-NM
    NEGR1 qPCR Primer Pairs, Mouse MP200587

    NEGR1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    NEGR1 cDNA ORF Clone in Cloning Vector, Human HG11181-M
    NEGR1 cDNA ORF Clone, Human, untagged HG11181-UT
    NEGR1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11181-ACG
    NEGR1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11181-ACGLN
    NEGR1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11181-ACR
    NEGR1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11181-CF
    NEGR1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11181-NF
    NEGR1 cDNA ORF Clone, Human, C-His tag HG11181-CH
    NEGR1 cDNA ORF Clone, Human, N-His tag HG11181-NH
    NEGR1 cDNA ORF Clone, Human, C-HA tag HG11181-CY
    NEGR1 cDNA ORF Clone, Human, N-HA tag HG11181-NY
    NEGR1 cDNA ORF Clone, Human, C-Myc tag HG11181-CM
    NEGR1 cDNA ORF Clone, Human, N-Myc tag HG11181-NM
    NEGR1 qPCR Primer Pairs, Human HP101087
    info info
    添加购物车成功! 添加购物车失败!