NDUFV1 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51814-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NDUFV1 Reagents
CRO Services
Product recommended

All NDUFV1 Reagents
NDUFV1 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1395 bp
Description
Full length Clone DNA of Mouse NADH dehydrogenase (ubiquinone) flavoprotein 1 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NDUFV1 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
CI-51kD cDNA ORF Clone, Mouse
NDUFV1 Background Information
Full Name
NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa

NDUFV1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NDUFV1 cDNA ORF Clone in Cloning Vector, Rat RG81524-G

NDUFV1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NDUFV1 cDNA ORF Clone in Cloning Vector, Mouse MG51814-G
NDUFV1 cDNA ORF Clone, Mouse, untagged MG51814-UT
NDUFV1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51814-ACGLN
NDUFV1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51814-ACG
NDUFV1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51814-ANG
NDUFV1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51814-ACR
NDUFV1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51814-ANR
NDUFV1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51814-CF
NDUFV1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51814-NF
NDUFV1 cDNA ORF Clone, Mouse, C-His tag MG51814-CH
NDUFV1 cDNA ORF Clone, Mouse, N-His tag MG51814-NH
NDUFV1 cDNA ORF Clone, Mouse, C-HA tag MG51814-CY
NDUFV1 cDNA ORF Clone, Mouse, N-HA tag MG51814-NY
NDUFV1 cDNA ORF Clone, Mouse, N-Myc tag MG51814-NM
NDUFV1 qPCR Primer Pairs, Mouse MP201687

NDUFV1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NDUFV1 cDNA ORF Clone in Cloning Vector, Human HG16710-U
NDUFV1 cDNA ORF Clone, Human, untagged HG16710-UT
NDUFV1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16710-ACGLN
NDUFV1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16710-ACG
NDUFV1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16710-ANG
NDUFV1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16710-ACR
NDUFV1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16710-ANR
NDUFV1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16710-CF
NDUFV1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16710-NF
NDUFV1 cDNA ORF Clone, Human, C-His tag HG16710-CH
NDUFV1 cDNA ORF Clone, Human, N-His tag HG16710-NH
NDUFV1 cDNA ORF Clone, Human, C-HA tag HG16710-CY
NDUFV1 cDNA ORF Clone, Human, N-HA tag HG16710-NY
NDUFV1 cDNA ORF Clone, Human, C-Myc tag HG16710-CM
NDUFV1 cDNA ORF Clone, Human, N-Myc tag HG16710-NM
info info
添加购物车成功! 添加购物车失败!