NDUFB5 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51267-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NDUFB5 Reagents
CRO Services
Product recommended

All NDUFB5 Reagents
NDUFB5 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
570 bp
Description
Full length Clone DNA of Mouse NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NDUFB5 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
0610007D05Rik cDNA ORF Clone, Mouse;AU015782 cDNA ORF Clone, Mouse;SGDH cDNA ORF Clone, Mouse
NDUFB5 Background Information
Full Name
NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa

NDUFB5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NDUFB5 cDNA ORF Clone in Cloning Vector, Mouse MG51267-U
NDUFB5 cDNA ORF Clone, Mouse, untagged MG51267-UT
NDUFB5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51267-ACG
NDUFB5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51267-ACGLN
NDUFB5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51267-ANG
NDUFB5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51267-ACR
NDUFB5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51267-ANR
NDUFB5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51267-CF
NDUFB5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51267-NF
NDUFB5 cDNA ORF Clone, Mouse, C-His tag MG51267-CH
NDUFB5 cDNA ORF Clone, Mouse, N-His tag MG51267-NH
NDUFB5 cDNA ORF Clone, Mouse, N-HA tag MG51267-NY
NDUFB5 cDNA ORF Clone, Mouse, C-Myc tag MG51267-CM
NDUFB5 cDNA ORF Clone, Mouse, N-Myc tag MG51267-NM
NDUFB5 qPCR Primer Pairs, Mouse MP201149

NDUFB5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NDUFB5 cDNA ORF Clone in Cloning Vector, Human HG17023-U
NDUFB5 cDNA ORF Clone, Human, untagged HG17023-UT
NDUFB5 cDNA ORF Clone, Human, C-GFPSpark® tag HG17023-ACG
NDUFB5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17023-ACGLN
NDUFB5 cDNA ORF Clone, Human, N-GFPSpark® tag HG17023-ANG
NDUFB5 cDNA ORF Clone, Human, C-OFPSpark® tag HG17023-ACR
NDUFB5 cDNA ORF Clone, Human, N-OFPSpark® tag HG17023-ANR
NDUFB5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17023-CF
NDUFB5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17023-NF
NDUFB5 cDNA ORF Clone, Human, C-His tag HG17023-CH
NDUFB5 cDNA ORF Clone, Human, N-His tag HG17023-NH
NDUFB5 cDNA ORF Clone, Human, C-HA tag HG17023-CY
NDUFB5 cDNA ORF Clone, Human, N-HA tag HG17023-NY
NDUFB5 cDNA ORF Clone, Human, C-Myc tag HG17023-CM
NDUFB5 cDNA ORF Clone, Human, N-Myc tag HG17023-NM
info info
添加购物车成功! 添加购物车失败!