NDUFAF1 cDNA ORF Clone, Mouse, untagged

Cat: MG51536-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NDUFAF1 Reagents
CRO Services
Product recommended

All NDUFAF1 Reagents
NDUFAF1 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
993 bp
Description
Full length Clone DNA of Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NDUFAF1 cDNA ORF Clone, Mouse, untagged Alternative Names
2410001M24Rik cDNA ORF Clone, Mouse;CGI-65 cDNA ORF Clone, Mouse;CIA30 cDNA ORF Clone, Mouse
NDUFAF1 Background Information
Full Name
NADH dehydrogenase (ubiquinone) complex I, assembly factor 1

NDUFAF1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
NDUFAF1 cDNA ORF Clone in Cloning Vector, Canine DG70166-U

NDUFAF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NDUFAF1 cDNA ORF Clone in Cloning Vector, Mouse MG51536-G
NDUFAF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51536-ACG
NDUFAF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51536-ACGLN
NDUFAF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51536-ANG
NDUFAF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51536-ACR
NDUFAF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51536-ANR
NDUFAF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51536-CF
NDUFAF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51536-NF
NDUFAF1 cDNA ORF Clone, Mouse, C-His tag MG51536-CH
NDUFAF1 cDNA ORF Clone, Mouse, N-His tag MG51536-NH
NDUFAF1 cDNA ORF Clone, Mouse, C-HA tag MG51536-CY
NDUFAF1 cDNA ORF Clone, Mouse, N-HA tag MG51536-NY
NDUFAF1 cDNA ORF Clone, Mouse, C-Myc tag MG51536-CM
NDUFAF1 cDNA ORF Clone, Mouse, N-Myc tag MG51536-NM
NDUFAF1 qPCR Primer Pairs, Mouse MP201420

NDUFAF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NDUFAF1 cDNA ORF Clone in Cloning Vector, Human HG17075-U
NDUFAF1 cDNA ORF Clone, Human, untagged HG17075-UT
NDUFAF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17075-ACG
NDUFAF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17075-ACGLN
NDUFAF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17075-ANG
NDUFAF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17075-ACR
NDUFAF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17075-ANR
NDUFAF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17075-CF
NDUFAF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17075-NF
NDUFAF1 cDNA ORF Clone, Human, C-His tag HG17075-CH
NDUFAF1 cDNA ORF Clone, Human, N-His tag HG17075-NH
NDUFAF1 cDNA ORF Clone, Human, C-HA tag HG17075-CY
NDUFAF1 cDNA ORF Clone, Human, N-HA tag HG17075-NY
NDUFAF1 cDNA ORF Clone, Human, C-Myc tag HG17075-CM
NDUFAF1 cDNA ORF Clone, Human, N-Myc tag HG17075-NM
info info
添加购物车成功! 添加购物车失败!