NCKIPSD cDNA ORF Clone, Mouse, C-His tag

Cat: MG51832-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NCKIPSD Reagents
CRO Services
Product recommended

All NCKIPSD Reagents
NCKIPSD cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2145 bp
Description
Full length Clone DNA of Mouse NCK interacting protein with SH3 domain with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NCKIPSD cDNA ORF Clone, Mouse, C-His tag Alternative Names
AF3P21 cDNA ORF Clone, Mouse;DIP1 cDNA ORF Clone, Mouse;ORF1 cDNA ORF Clone, Mouse;SPIN90 cDNA ORF Clone, Mouse;Wasbp cDNA ORF Clone, Mouse;WASLBP cDNA ORF Clone, Mouse;WISH cDNA ORF Clone, Mouse
NCKIPSD Background Information

NCKIPSD is localized exclusively in the cell nucleus. It plays a role in signal transduction, and may function in the maintenance of sarcomeres and in the assembly of myofibrils into sarcomeres. NCKIPSD also plays an important role in stress fiber formation. NCKIPSD gene is involved in therapy-related leukemia by a chromosomal translocation t(3;11)(p21;q23) that involves this gene and the myeloid/lymphoid leukemia gene. Alternative splicing occurs in this locus and two transcript variants encoding distinct isoforms have been identified. NCKIPSD is a SH3 domain protein. Fas ligand is a cytotoxic effector molecule of T and NK cells which is characterized by an intracellular N-terminal polyproline region that serves as a docking site for SH3 and WW domain proteins. Several previously described Fas ligand-interacting SH3 domain proteins turned out to be crucial for the regulation of storage, expression and function of the death factor. Recent observations, however, indicate that Fas ligand is also subject to posttranslational modifications including shedding and intramembrane proteolysis.

Full Name
NCK interacting protein with SH3 domain
References
  • Satoh, S, et al. (2001) mDia-interacting protein acts downstream of Rho-mDia and modifies Src activation and stress fiber formation. J Biol Chem. 276(42):39290-4.
  • de Bernard M, et al. (2000) The VacA toxin of Helicobacter pylori identifies a new intermediate filament-interacting protein. EMBO J. 19(1):48-56.
  • Sano K, et al. (2000) Novel SH3 protein encoded by the AF3p21 gene is fused to the mixed lineage leukemia protein in a therapy-related leukemia with t(3;11) (p21;q23). Blood. 95(3): 1066-8.
  • Voss M, et al. (2009) Identification of SH3 domain interaction partners of human FasL (CD178) by phage display screening. BMC Immunol. 10:53.
  • NCKIPSD cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    NCKIPSD cDNA ORF Clone in Cloning Vector, Mouse MG51832-G
    NCKIPSD cDNA ORF Clone, Mouse, untagged MG51832-UT
    NCKIPSD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51832-ACGLN
    NCKIPSD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51832-ACG
    NCKIPSD cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51832-ANG
    NCKIPSD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51832-ACR
    NCKIPSD cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51832-ANR
    NCKIPSD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51832-CF
    NCKIPSD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51832-NF
    NCKIPSD cDNA ORF Clone, Mouse, N-His tag MG51832-NH
    NCKIPSD cDNA ORF Clone, Mouse, C-HA tag MG51832-CY
    NCKIPSD cDNA ORF Clone, Mouse, N-HA tag MG51832-NY
    NCKIPSD cDNA ORF Clone, Mouse, C-Myc tag MG51832-CM
    NCKIPSD cDNA ORF Clone, Mouse, N-Myc tag MG51832-NM
    NCKIPSD qPCR Primer Pairs, Mouse MP201705

    NCKIPSD cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    NCKIPSD cDNA ORF Clone in Cloning Vector, Human HG13642-G
    NCKIPSD cDNA ORF Clone, Human, untagged HG13642-UT
    NCKIPSD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13642-ACGLN
    NCKIPSD cDNA ORF Clone, Human, C-GFPSpark® tag HG13642-ACG
    NCKIPSD cDNA ORF Clone, Human, N-GFPSpark® tag HG13642-ANG
    NCKIPSD cDNA ORF Clone, Human, C-OFPSpark® tag HG13642-ACR
    NCKIPSD cDNA ORF Clone, Human, N-OFPSpark® tag HG13642-ANR
    NCKIPSD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13642-CF
    NCKIPSD cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13642-NF
    NCKIPSD cDNA ORF Clone, Human, C-His tag HG13642-CH
    NCKIPSD cDNA ORF Clone, Human, N-His tag HG13642-NH
    NCKIPSD cDNA ORF Clone, Human, C-HA tag HG13642-CY
    NCKIPSD cDNA ORF Clone, Human, N-HA tag HG13642-NY
    NCKIPSD cDNA ORF Clone, Human, C-Myc tag HG13642-CM
    NCKIPSD cDNA ORF Clone, Human, N-Myc tag HG13642-NM
    NCKIPSD qPCR Primer Pairs, Human HP102325
    info info
    添加购物车成功! 添加购物车失败!