Quick Order

Mouse NCF2 / NCF-2 / P67phox Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse NCF2 cDNA Clone Product Information
NCBI RefSeq:NM_010877.4
RefSeq ORF Size:1578bp
cDNA Description:Full length Clone DNA of Mus musculus neutrophil cytosolic factor 2.
Gene Synonym:NOXA2, Ncf-2, p67phox
Species:Mouse
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

NCF2, also known as NCF-2 and p67phox, is a subunit of the multi-protein NADPH oxidase complex. NCF2, NCF1, and a membrane bound cytochrome b558 are required for activation of the latent NADPH oxidase. This oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Mutations in NCF2 gene, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease, a disease that causes recurrent infections by catalase-positive organisms.

References
  • Wientjes FB. et al., 1996, Semin Cell Biol. 6 (6): 357-65.
  • DeLeo FR. et al., 1997, J Leukoc Biol. 60 (6): 677-91.
  • Dorseuil O. et al., 1997, C R Seances Soc Biol Fil. 191 (2): 237-46.
  • Size / Price
    Catalog: MG52449-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"