After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse NAALADL1 ORF mammalian expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse NAALADL1 cDNA Clone Product Information
NCBI RefSeq:NM_001009546.1
RefSeq ORF Size:2238bp
cDNA Description:Full length Clone DNA of Mus musculus N-acetylated alpha-linked acidic dipeptidase-like 1 with N terminal Myc tag.
Gene Synonym:Gm964, Naaladasel, Naaladl1
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

N-acetylated-alpha-linked acidic dipeptidase-like protein, also known as NAALADL1, NAALADase L, and Ileal dipeptidylpeptidase, is a Single-pass type I I membrane protein and a member of the peptidase M28 family and M28B subfamily. NAALADase L is mainly expressed in the distal small intestine. It is also expressed in the spleen and testis and Weakly expressed in the brain, locating mainly to the brain stem, amygdala, thalamus and ventral striatum. NAALADase L is a chloride-activated, membrane bound, metallopeptidase that cleaves the endogenous neuropeptide N-acetyl-aspartyl-glutamate (NAAG). NAAG acts as a partial NMDA agonist as well as a full agonist at the presynaptic metabotropic glutamate receptor 3 (mGluR3), where it acts to reduce glutamate release. NAALADase L also exhibits a dipeptidyl-peptidase IV type activity. NAALADase inhibition may be a novel therapeutic approach to reduce or inhibit heightened aggressiveness, and possibly to treat aggressive behavior associated with psychiatric disorders.

References
  • Stauch BL. 1989, Neurosci Lett. 100 (1-3): 295-300.
  • Shneider BL. et al., 1997, J. Biol. Chem. 272: 31006-15.
  • Pangalos MN. et al., 1999, J. Biol. Chem. 274: 8470-83.
  • Thomas AG. et al., 1999, Brain Res. 843 (1-2): 48-52.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"