MUC1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50877-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MUC1 Reagents
CRO Services
Product recommended

All MUC1 Reagents
MUC1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1896 bp
Description
Full length Clone DNA of Mouse mucin 1, transmembrane with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MUC1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
CD227 cDNA ORF Clone, Mouse;EMA cDNA ORF Clone, Mouse;Muc-1 cDNA ORF Clone, Mouse
MUC1 Background Information

Mucin 1, cell surface associated (MUC1) or polymorphic epithelial mucin (PEM) is a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. This protein is expressed on the apical surface of epithelial cells that line the mucosal surfaces of many different tissues including lung, breast stomach and pancreas. MUC-1/CC1/CD227 Exclusively located in the apical domain of the plasma membrane of highly polarized epithelial cells. After endocytosis, internalized and recycled to the cell membrane. This protein is proteolytically cleaved into alpha and beta subunits that form a heterodimeric complex. The N-terminal alpha subunit functions in cell-adhesion and the C-terminal beta subunit is involved in cell signaling. Overexpression, aberrant intracellular localization, and changes in glycosylation of this protein have been associated with carcinomas. The alpha subunit has cell adhesive properties. MUC-1/CC1/CD227 Can act both as an adhesion and an anti-adhesion protein. This protein May provide a protective layer on epithelial cells against bacterial and enzyme attack. The beta subunit contains a C-terminal domain which is involved in cell signaling, through phosphorylations and protein-protein interactions. MUC-1/CC1/CD227 participated in modulates signaling in ERK, SRC and NF-kappa-B pathways. In activated T-cells, MUC-1/CC1/CD227 influences directly or indirectly the Ras/MAPK pathway. MUC-1/CC1/CD227 Promotes tumor progression and regulates TP53-mediated transcription and determines cell fate in the genotoxic stress response. Binds, together with KLF4, the PE21 promoter element of TP53 and represses TP53 activity.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
mucin 1, cell surface associated
References
  • Brayman M, et al. (2004) MUC1: a multifunctional cell surface component of reproductive tissue epithelia. Reprod Biol Endocrinol 2: 4.
  • Schroeder J A, et al. (2001) Transgenic MUC1 interacts with epidermal growth factor receptor and correlates with mitogen-activated protein kinase activation in the mouse mammary gland. J Biol Chem. 276 (16): 13057-64.
  • Li Y, et al. (2001) The epidermal growth factor receptor regulates interaction of the human DF3/MUC1 carcinoma antigen with c-Src and beta-catenin. J Biol Chem. 276 (38): 35239-42.
  • MUC1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    MUC1 cDNA ORF Clone in Cloning Vector, Mouse MG50877-G
    MUC1 cDNA ORF Clone, Mouse, untagged MG50877-UT
    MUC1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50877-ACGLN
    MUC1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50877-ACG
    MUC1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50877-ACR
    MUC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50877-CF
    MUC1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50877-NF
    MUC1 cDNA ORF Clone, Mouse, C-His tag MG50877-CH
    MUC1 cDNA ORF Clone, Mouse, N-His tag MG50877-NH
    MUC1 cDNA ORF Clone, Mouse, C-HA tag MG50877-CY
    MUC1 cDNA ORF Clone, Mouse, N-HA tag MG50877-NY
    MUC1 cDNA ORF Clone, Mouse, C-Myc tag MG50877-CM
    MUC1 qPCR Primer Pairs, Mouse MP200848

    MUC1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    MUC1 cDNA ORF Clone in Cloning Vector, Human HG12123-M
    MUC1 cDNA ORF Clone, Human, untagged HG12123-UT
    MUC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12123-ACG
    MUC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12123-ACGLN
    MUC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12123-ACR
    MUC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12123-CF
    MUC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12123-NF
    MUC1 cDNA ORF Clone, Human, C-His tag HG12123-CH
    MUC1 cDNA ORF Clone, Human, N-His tag HG12123-NH
    MUC1 cDNA ORF Clone, Human, C-HA tag HG12123-CY
    MUC1 cDNA ORF Clone, Human, N-HA tag HG12123-NY
    MUC1 cDNA ORF Clone, Human, C-Myc tag HG12123-CM
    MUC1 cDNA ORF Clone, Human, N-Myc tag HG12123-NM
    MUC1 qPCR Primer Pairs, Human HP101650
    info info
    添加购物车成功! 添加购物车失败!