MTFR1L cDNA ORF Clone, Mouse, untagged

Cat: MG51657-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MTFR1L Reagents
CRO Services
Product recommended

All MTFR1L Reagents
MTFR1L cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
870 bp
Description
Full length Clone DNA of Mouse mitochondrial fission regulator 1-like.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MTFR1L cDNA ORF Clone, Mouse, untagged Alternative Names
2410166I05Rik cDNA ORF Clone, Mouse;AI480750 cDNA ORF Clone, Mouse;Fam54b cDNA ORF Clone, Mouse
MTFR1L Background Information
Full Name
mitochondrial fission regulator 1-like

MTFR1L cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MTFR1L cDNA ORF Clone in Cloning Vector, Rat RG8A1600-U
MTFR1L Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1600-ACGLN

MTFR1L cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MTFR1L cDNA ORF Clone in Cloning Vector, Mouse MG51657-G
MTFR1L Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51657-ACGLN
MTFR1L cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51657-ACG
MTFR1L cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51657-ANG
MTFR1L cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51657-ACR
MTFR1L cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51657-ANR
MTFR1L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51657-CF
MTFR1L cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51657-NF
MTFR1L cDNA ORF Clone, Mouse, C-His tag MG51657-CH
MTFR1L cDNA ORF Clone, Mouse, N-His tag MG51657-NH
MTFR1L cDNA ORF Clone, Mouse, C-HA tag MG51657-CY
MTFR1L cDNA ORF Clone, Mouse, N-HA tag MG51657-NY
MTFR1L cDNA ORF Clone, Mouse, C-Myc tag MG51657-CM
MTFR1L cDNA ORF Clone, Mouse, N-Myc tag MG51657-NM
MTFR1L qPCR Primer Pairs, Mouse MP201530

MTFR1L cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MTFR1L cDNA ORF Clone in Cloning Vector, Human HG25935-U
MTFR1L cDNA ORF Clone, Human, untagged HG25935-UT
MTFR1L cDNA ORF Clone, Human, C-GFPSpark® tag HG25935-ACG
MTFR1L Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG25935-ACGLN
MTFR1L cDNA ORF Clone, Human, N-GFPSpark® tag HG25935-ANG
MTFR1L cDNA ORF Clone, Human, C-OFPSpark® tag HG25935-ACR
MTFR1L cDNA ORF Clone, Human, N-OFPSpark® tag HG25935-ANR
MTFR1L cDNA ORF Clone, Human, C-DDK (Flag®) tag HG25935-CF
MTFR1L cDNA ORF Clone, Human, N-DDK (Flag®) tag HG25935-NF
MTFR1L cDNA ORF Clone, Human, C-His tag HG25935-CH
MTFR1L cDNA ORF Clone, Human, N-His tag HG25935-NH
MTFR1L cDNA ORF Clone, Human, C-HA tag HG25935-CY
MTFR1L cDNA ORF Clone, Human, N-HA tag HG25935-NY
MTFR1L cDNA ORF Clone, Human, C-Myc tag HG25935-CM
MTFR1L cDNA ORF Clone, Human, N-Myc tag HG25935-NM
info info
添加购物车成功! 添加购物车失败!