MTFP1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52129-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MTFP1 Reagents
CRO Services
Product recommended

All MTFP1 Reagents
MTFP1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
501 bp
Description
Full length Clone DNA of Mouse mitochondrial fission process 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MTFP1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
1700020C11Rik cDNA ORF Clone, Mouse;2610507A21Rik cDNA ORF Clone, Mouse;AV005788 cDNA ORF Clone, Mouse;Mtp18 cDNA ORF Clone, Mouse
MTFP1 Background Information
Full Name
mitochondrial fission process 1

MTFP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MTFP1 cDNA ORF Clone in Cloning Vector, Rat RG80526-U
MTFP1 cDNA ORF Clone, Rat, untagged RG80526-UT
MTFP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80526-ACGLN
MTFP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80526-ACG
MTFP1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80526-ANG
MTFP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80526-ACR
MTFP1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80526-ANR
MTFP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80526-CF
MTFP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80526-NF
MTFP1 cDNA ORF Clone, Rat, C-His tag RG80526-CH
MTFP1 cDNA ORF Clone, Rat, N-His tag RG80526-NH
MTFP1 cDNA ORF Clone, Rat, C-HA tag RG80526-CY
MTFP1 cDNA ORF Clone, Rat, N-HA tag RG80526-NY
MTFP1 cDNA ORF Clone, Rat, C-Myc tag RG80526-CM
MTFP1 cDNA ORF Clone, Rat, N-Myc tag RG80526-NM
MTFP1 qPCR Primer Pairs, Rat RP300490

MTFP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MTFP1 cDNA ORF Clone in Cloning Vector, Mouse MG52129-U
MTFP1 cDNA ORF Clone, Mouse, untagged MG52129-UT
MTFP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52129-ACGLN
MTFP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52129-ACG
MTFP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52129-ANG
MTFP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52129-ACR
MTFP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52129-ANR
MTFP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52129-CF
MTFP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52129-NF
MTFP1 cDNA ORF Clone, Mouse, C-His tag MG52129-CH
MTFP1 cDNA ORF Clone, Mouse, N-His tag MG52129-NH
MTFP1 cDNA ORF Clone, Mouse, C-HA tag MG52129-CY
MTFP1 cDNA ORF Clone, Mouse, N-HA tag MG52129-NY
MTFP1 cDNA ORF Clone, Mouse, C-Myc tag MG52129-CM
MTFP1 qPCR Primer Pairs, Mouse MP202002

MTFP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MTFP1 cDNA ORF Clone in Cloning Vector, Human HG16529-U
MTFP1 cDNA ORF Clone, Human, untagged HG16529-UT
MTFP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16529-ACGLN
MTFP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16529-ACG
MTFP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16529-ANG
MTFP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16529-ACR
MTFP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16529-ANR
MTFP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16529-CF
MTFP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16529-NF
MTFP1 cDNA ORF Clone, Human, C-His tag HG16529-CH
MTFP1 cDNA ORF Clone, Human, N-His tag HG16529-NH
MTFP1 cDNA ORF Clone, Human, C-HA tag HG16529-CY
MTFP1 cDNA ORF Clone, Human, N-HA tag HG16529-NY
MTFP1 cDNA ORF Clone, Human, C-Myc tag HG16529-CM
MTFP1 cDNA ORF Clone, Human, N-Myc tag HG16529-NM
info info
添加购物车成功! 添加购物车失败!