MTERFD1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52670-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MTERFD1 Reagents
CRO Services
Product recommended

All MTERFD1 Reagents
MTERFD1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1239 bp
Description
Full length Clone DNA of Mouse MTERF domain containing 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MTERFD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MTERFD1 cDNA ORF Clone in Cloning Vector, Mouse MG52670-G
MTERFD1 cDNA ORF Clone, Mouse, untagged MG52670-UT
MTERFD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52670-ACG
MTERFD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52670-ACGLN
MTERFD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52670-ANG
MTERFD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52670-ACR
MTERFD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52670-ANR
MTERFD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52670-CF
MTERFD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52670-NF
MTERFD1 cDNA ORF Clone, Mouse, C-His tag MG52670-CH
MTERFD1 cDNA ORF Clone, Mouse, N-His tag MG52670-NH
MTERFD1 cDNA ORF Clone, Mouse, C-HA tag MG52670-CY
MTERFD1 cDNA ORF Clone, Mouse, N-HA tag MG52670-NY
MTERFD1 cDNA ORF Clone, Mouse, C-Myc tag MG52670-CM
MTERFD1 qPCR Primer Pairs, Mouse MP202541

MTERFD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MTERFD1 cDNA ORF Clone in Cloning Vector, Human HG14200-G
MTERFD1 cDNA ORF Clone, Human, untagged HG14200-UT
MTERFD1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14200-ACGLN
MTERFD1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14200-ACG
MTERFD1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14200-ANG
MTERFD1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14200-ACR
MTERFD1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14200-ANR
MTERFD1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14200-CF
MTERFD1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14200-NF
MTERFD1 cDNA ORF Clone, Human, C-His tag HG14200-CH
MTERFD1 cDNA ORF Clone, Human, N-His tag HG14200-NH
MTERFD1 cDNA ORF Clone, Human, C-HA tag HG14200-CY
MTERFD1 cDNA ORF Clone, Human, N-HA tag HG14200-NY
MTERFD1 cDNA ORF Clone, Human, C-Myc tag HG14200-CM
MTERFD1 cDNA ORF Clone, Human, N-Myc tag HG14200-NM
MTERFD1 qPCR Primer Pairs, Human HP102850
info info
添加购物车成功! 添加购物车失败!