MT-ND4L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51231-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MT-ND4L Reagents
CRO Services
Product recommended

All MT-ND4L Reagents
MT-ND4L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
297 bp
Description
Full length Clone DNA of Mouse NADH dehydrogenase 4L, mitochondrial with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MT-ND4L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
ND4L cDNA ORF Clone, Mouse
MT-ND4L Background Information
Full Name
mitochondrially encoded NADH 4L dehydrogenase

MT-ND4L cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MT-ND4L cDNA ORF Clone in Cloning Vector, Rat RG80473-U
MT-ND4L cDNA ORF Clone, Rat, untagged RG80473-UT
MT-ND4L Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80473-ACGLN
MT-ND4L cDNA ORF Clone, Rat, C-GFPSpark® tag RG80473-ACG
MT-ND4L cDNA ORF Clone, Rat, N-GFPSpark® tag RG80473-ANG
MT-ND4L cDNA ORF Clone, Rat, C-OFPSpark® tag RG80473-ACR
MT-ND4L cDNA ORF Clone, Rat, N-OFPSpark® tag RG80473-ANR
MT-ND4L cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80473-CF
MT-ND4L cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80473-NF
MT-ND4L cDNA ORF Clone, Rat, C-His tag RG80473-CH
MT-ND4L cDNA ORF Clone, Rat, N-His tag RG80473-NH
MT-ND4L cDNA ORF Clone, Rat, C-HA tag RG80473-CY
MT-ND4L cDNA ORF Clone, Rat, N-HA tag RG80473-NY
MT-ND4L cDNA ORF Clone, Rat, C-Myc tag RG80473-CM
MT-ND4L cDNA ORF Clone, Rat, N-Myc tag RG80473-NM
MT-ND4L qPCR Primer Pairs, Rat RP300437

MT-ND4L cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MT-ND4L cDNA ORF Clone in Cloning Vector, Mouse MG51231-U
MT-ND4L cDNA ORF Clone, Mouse, untagged MG51231-UT
MT-ND4L cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51231-ACG
MT-ND4L Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51231-ACGLN
MT-ND4L cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51231-ANG
MT-ND4L cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51231-ACR
MT-ND4L cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51231-ANR
MT-ND4L cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51231-NF
MT-ND4L cDNA ORF Clone, Mouse, C-His tag MG51231-CH
MT-ND4L cDNA ORF Clone, Mouse, N-His tag MG51231-NH
MT-ND4L cDNA ORF Clone, Mouse, C-HA tag MG51231-CY
MT-ND4L cDNA ORF Clone, Mouse, N-HA tag MG51231-NY
MT-ND4L cDNA ORF Clone, Mouse, C-Myc tag MG51231-CM
MT-ND4L cDNA ORF Clone, Mouse, N-Myc tag MG51231-NM
MT-ND4L qPCR Primer Pairs, Mouse MP201114
info info
添加购物车成功! 添加购物车失败!