After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse GDF-8/Myostatin/MSTN Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse MSTN cDNA Clone Product Information
NCBI RefSeq:NM_010834.2
RefSeq ORF Size:1131bp
cDNA Description:Full length Clone DNA of Mus musculus myostatin.
Gene Synonym:Cmpt, Gdf8, MGC124261, MGC124262, MGC124263, Mstn
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mMSTN
Restriction Site:KpnI + XbaI (6.1kb + 1.13kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse MSTN Gene Plasmid Map
Mouse MSTN Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

GDF-8 / Myostatin / MSTN is a member of the bone morphogenetic protein (BMP) family and the TGF-beta superfamily. This group of proteins is characterized by a polybasic proteolytic processing site which is cleaved to produce a mature protein containing seven conserved cysteine residues. The members of this family are regulators of cell growth and differentiation in both embryonic and adult tissues. GDF-8 / Myostatin / MSTN is highly expressed in skeletal muscle, and myostatin loss-of-function leads to doubling of skeletal muscle mass. Experiments in mice have improved that GDF-8 / Myostatin / MSTN is a key regulator of mesenchymal stem cell proliferation and differentiation, and mice lacking Myostatin encoding gene show decreased body fat and a generalized increase in bone density and strength. The increase in bone density is observed in most anatomical regions, including the limbs, spine, and jaw, and myostatin inhibitors have been observed to significantly increase bone formation. GDF-8 / Myostatin / MSTN is also expressed in the early phases of fracture healing, and GDF-8 / Myostatin / MSTN deficiency leads to increased fracture callus size and strength. Together, these data suggest that GDF-8 / Myostatin / MSTN has direct effects on the proliferation and differentiation of osteoprogenitor cells, and that GDF-8/Myostatin/MSTN antagonists and inhibitors are likely to enhance both muscle mass and bone strength.

References
  • Elkasrawy MN, et al. (2010) Myostatin (GDF-8) as a key factor linking muscle mass and bone structure. J Musculoskelet Neuronal Interact. 10(1): 56-63.
  • Kambadur R, et al. (1997) Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Res. 7 (9): 910-6.
  • McPherron AC, et al. (1997) Regulation of skeletal muscle mass in mice by a new TGF-beta superfamily member. Nature. 387 (6628): 83-90.
  • Size / Price
    Catalog: MG50441-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Mouse MSTN Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"