MST4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51088-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MST4 Reagents
CRO Services
Product recommended

All MST4 Reagents
MST4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1020 bp
Description
Full length Clone DNA of Mouse RIKEN cDNA 2610018G03 gene with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MST4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
2610018G03Rik cDNA ORF Clone, Mouse;Mst4 cDNA ORF Clone, Mouse
MST4 Background Information

MST4, also known as mammalian STE20-like protein kinase 4, is a novel member of the germinal center kinase subfamily of human Ste20-like kinases and is closely related to MST3. The 416 amino acid full-length MST4 contains a C-terminal regulatory domain and an N-terminal kinase domain, both of which are required for full activation of the kinase. MST4 is highly expressed in placenta, thymus, and peripheral blood leukocytes. MST4 specifically activates ERK but not JNK or p38 MAPK in transient transfected cells or in stable cell lines, and thus is biologically active in the activation of MEK/ERK pathway mediating cell growth and transformation. Further, MST4 kinase activity is stimulated significantly by epidermal growth factor receptor (EGFR) ligands, which are known to promote growth of certain cancer cells. Accordingly, MST4 have a potential role in signal transduction pathways involved in cancer progression. Three alternatively spliced isoform of MST4 have been isolated, and isoform 3 lacks an exon encoding kinase domain and may function as a dominant-negative regulator of the MST4 kinase.

Full Name
serine/threonine protein kinase 26
References

1. Qian, Z. et al., 2001, J Biol Chem. 276 :22439-45.

2. Lin, JL. et al., 2001, Oncogene. 20: 6559-6569.

3. Sung V, et al., 2003, Cancer research. 63: 3356-63.

4. Ma, X. et al., 2007, Molecular biology of the cell. 18:1965-78.

5. ten Klooster JP, et al., 2009, Developmental cell. 16:551-62.

MST4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MST4 cDNA ORF Clone in Cloning Vector, Mouse MG51088-G
MST4 cDNA ORF Clone, Mouse, untagged MG51088-UT
MST4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51088-ACGLN
MST4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51088-ACG
MST4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51088-ANG
MST4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51088-ACR
MST4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51088-ANR
MST4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51088-CF
MST4 cDNA ORF Clone, Mouse, C-His tag MG51088-CH
MST4 cDNA ORF Clone, Mouse, N-His tag MG51088-NH
MST4 cDNA ORF Clone, Mouse, C-HA tag MG51088-CY
MST4 cDNA ORF Clone, Mouse, N-HA tag MG51088-NY
MST4 cDNA ORF Clone, Mouse, C-Myc tag MG51088-CM
MST4 cDNA ORF Clone, Mouse, N-Myc tag MG51088-NM
MST4 qPCR Primer Pairs, Mouse MP201046

MST4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MST4 cDNA ORF Clone in Cloning Vector, Human HG10667-M
MST4 cDNA ORF Clone, Human, untagged HG10667-UT
MST4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10667-ACGLN
MST4 cDNA ORF Clone, Human, C-GFPSpark® tag HG10667-ACG
MST4 cDNA ORF Clone, Human, N-GFPSpark® tag HG10667-ANG
MST4 cDNA ORF Clone, Human, C-OFPSpark® tag HG10667-ACR
MST4 cDNA ORF Clone, Human, N-OFPSpark® tag HG10667-ANR
MST4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10667-CF
MST4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10667-NF
MST4 cDNA ORF Clone, Human, C-His tag HG10667-CH
MST4 cDNA ORF Clone, Human, N-His tag HG10667-NH
MST4 cDNA ORF Clone, Human, C-HA tag HG10667-CY
MST4 cDNA ORF Clone, Human, N-HA tag HG10667-NY
MST4 cDNA ORF Clone, Human, C-Myc tag HG10667-CM
MST4 cDNA ORF Clone, Human, N-Myc tag HG10667-NM
MST4 qPCR Primer Pairs, Human HP100634
info info
添加购物车成功! 添加购物车失败!