MRPS9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG52054-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MRPS9 Reagents
CRO Services
Product recommended

All MRPS9 Reagents
MRPS9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1173 bp
Description
Full length Clone DNA of Mouse mitochondrial ribosomal protein S9 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRPS9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
2310002A08Rik cDNA ORF Clone, Mouse;AW322516 cDNA ORF Clone, Mouse;mg637 cDNA ORF Clone, Mouse;Mrp-S9 cDNA ORF Clone, Mouse;S9mt cDNA ORF Clone, Mouse
MRPS9 Background Information
Full Name
mitochondrial ribosomal protein S9

MRPS9 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MRPS9 cDNA ORF Clone in Cloning Vector, Rat RG8A1504-U
MRPS9 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1504-ACGLN

MRPS9 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MRPS9 cDNA ORF Clone in Cloning Vector, Mouse MG52054-U
MRPS9 cDNA ORF Clone, Mouse, untagged MG52054-UT
MRPS9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52054-ACGLN
MRPS9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52054-ACG
MRPS9 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52054-ANG
MRPS9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52054-ACR
MRPS9 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52054-ANR
MRPS9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52054-CF
MRPS9 cDNA ORF Clone, Mouse, C-His tag MG52054-CH
MRPS9 cDNA ORF Clone, Mouse, N-His tag MG52054-NH
MRPS9 cDNA ORF Clone, Mouse, C-HA tag MG52054-CY
MRPS9 cDNA ORF Clone, Mouse, N-HA tag MG52054-NY
MRPS9 cDNA ORF Clone, Mouse, C-Myc tag MG52054-CM
MRPS9 cDNA ORF Clone, Mouse, N-Myc tag MG52054-NM
MRPS9 qPCR Primer Pairs, Mouse MP201927

MRPS9 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MRPS9 cDNA ORF Clone in Cloning Vector, Human HG22764-U
MRPS9 cDNA ORF Clone, Human, untagged HG22764-UT
MRPS9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG22764-ACGLN
MRPS9 cDNA ORF Clone, Human, C-GFPSpark® tag HG22764-ACG
MRPS9 cDNA ORF Clone, Human, N-GFPSpark® tag HG22764-ANG
MRPS9 cDNA ORF Clone, Human, C-OFPSpark® tag HG22764-ACR
MRPS9 cDNA ORF Clone, Human, N-OFPSpark® tag HG22764-ANR
MRPS9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG22764-CF
MRPS9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG22764-NF
MRPS9 cDNA ORF Clone, Human, C-His tag HG22764-CH
MRPS9 cDNA ORF Clone, Human, N-His tag HG22764-NH
MRPS9 cDNA ORF Clone, Human, C-HA tag HG22764-CY
MRPS9 cDNA ORF Clone, Human, N-HA tag HG22764-NY
MRPS9 cDNA ORF Clone, Human, C-Myc tag HG22764-CM
MRPS9 cDNA ORF Clone, Human, N-Myc tag HG22764-NM
info info
添加购物车成功! 添加购物车失败!