MRPS25 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51693-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MRPS25 Reagents
CRO Services
Product recommended

All MRPS25 Reagents
MRPS25 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
516 bp
Description
Full length Clone DNA of Mouse mitochondrial ribosomal protein S25 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRPS25 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
2810429N01Rik cDNA ORF Clone, Mouse;Rpms25 cDNA ORF Clone, Mouse
MRPS25 Background Information
Full Name
mitochondrial ribosomal protein S25

MRPS25 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MRPS25 cDNA ORF Clone in Cloning Vector, Mouse MG51693-G
MRPS25 cDNA ORF Clone, Mouse, untagged MG51693-UT
MRPS25 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51693-ACG
MRPS25 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51693-ACGLN
MRPS25 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51693-ANG
MRPS25 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51693-ACR
MRPS25 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51693-ANR
MRPS25 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51693-CF
MRPS25 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51693-NF
MRPS25 cDNA ORF Clone, Mouse, C-His tag MG51693-CH
MRPS25 cDNA ORF Clone, Mouse, N-His tag MG51693-NH
MRPS25 cDNA ORF Clone, Mouse, C-HA tag MG51693-CY
MRPS25 cDNA ORF Clone, Mouse, N-HA tag MG51693-NY
MRPS25 cDNA ORF Clone, Mouse, N-Myc tag MG51693-NM
MRPS25 qPCR Primer Pairs, Mouse MP201566

MRPS25 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MRPS25 cDNA ORF Clone in Cloning Vector, Human HG16954-U
MRPS25 cDNA ORF Clone, Human, untagged HG16954-UT
MRPS25 cDNA ORF Clone, Human, C-GFPSpark® tag HG16954-ACG
MRPS25 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16954-ACGLN
MRPS25 cDNA ORF Clone, Human, N-GFPSpark® tag HG16954-ANG
MRPS25 cDNA ORF Clone, Human, C-OFPSpark® tag HG16954-ACR
MRPS25 cDNA ORF Clone, Human, N-OFPSpark® tag HG16954-ANR
MRPS25 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16954-CF
MRPS25 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16954-NF
MRPS25 cDNA ORF Clone, Human, C-His tag HG16954-CH
MRPS25 cDNA ORF Clone, Human, N-His tag HG16954-NH
MRPS25 cDNA ORF Clone, Human, C-HA tag HG16954-CY
MRPS25 cDNA ORF Clone, Human, N-HA tag HG16954-NY
MRPS25 cDNA ORF Clone, Human, C-Myc tag HG16954-CM
MRPS25 cDNA ORF Clone, Human, N-Myc tag HG16954-NM
info info
添加购物车成功! 添加购物车失败!