MRPS24 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51553-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MRPS24 Reagents
CRO Services
Product recommended

All MRPS24 Reagents
MRPS24 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
504 bp
Description
Full length Clone DNA of Mouse mitochondrial ribosomal protein S24 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRPS24 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
3110030K20Rik cDNA ORF Clone, Mouse;AI414579 cDNA ORF Clone, Mouse;Rpms24 cDNA ORF Clone, Mouse
MRPS24 Background Information
Full Name
mitochondrial ribosomal protein S24

MRPS24 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MRPS24 cDNA ORF Clone in Cloning Vector, Mouse MG51553-G
MRPS24 cDNA ORF Clone, Mouse, untagged MG51553-UT
MRPS24 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51553-ACG
MRPS24 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51553-ACGLN
MRPS24 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51553-ANG
MRPS24 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51553-ACR
MRPS24 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51553-ANR
MRPS24 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51553-CF
MRPS24 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51553-NF
MRPS24 cDNA ORF Clone, Mouse, C-His tag MG51553-CH
MRPS24 cDNA ORF Clone, Mouse, N-His tag MG51553-NH
MRPS24 cDNA ORF Clone, Mouse, C-HA tag MG51553-CY
MRPS24 cDNA ORF Clone, Mouse, N-HA tag MG51553-NY
MRPS24 cDNA ORF Clone, Mouse, C-Myc tag MG51553-CM
MRPS24 qPCR Primer Pairs, Mouse MP201437

MRPS24 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MRPS24 cDNA ORF Clone in Cloning Vector, Human HG16377-G
MRPS24 cDNA ORF Clone, Human, untagged HG16377-UT
MRPS24 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16377-ACGLN
MRPS24 cDNA ORF Clone, Human, C-GFPSpark® tag HG16377-ACG
MRPS24 cDNA ORF Clone, Human, N-GFPSpark® tag HG16377-ANG
MRPS24 cDNA ORF Clone, Human, C-OFPSpark® tag HG16377-ACR
MRPS24 cDNA ORF Clone, Human, N-OFPSpark® tag HG16377-ANR
MRPS24 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16377-CF
MRPS24 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16377-NF
MRPS24 cDNA ORF Clone, Human, C-His tag HG16377-CH
MRPS24 cDNA ORF Clone, Human, N-His tag HG16377-NH
MRPS24 cDNA ORF Clone, Human, C-HA tag HG16377-CY
MRPS24 cDNA ORF Clone, Human, N-HA tag HG16377-NY
MRPS24 cDNA ORF Clone, Human, C-Myc tag HG16377-CM
MRPS24 cDNA ORF Clone, Human, N-Myc tag HG16377-NM
MRPS24 qPCR Primer Pairs, Human HP105127
info info
添加购物车成功! 添加购物车失败!