MRPL38 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG52861-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MRPL38 Reagents
CRO Services
Product recommended

All MRPL38 Reagents
MRPL38 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1143 bp
Description
Full length Clone DNA of Mouse mitochondrial ribosomal protein L38 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRPL38 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
1110036N21Rik cDNA ORF Clone, Mouse;4733401F03Rik cDNA ORF Clone, Mouse;MRP-L3 cDNA ORF Clone, Mouse;R75240 cDNA ORF Clone, Mouse;Rpml3 cDNA ORF Clone, Mouse
MRPL38 Background Information
Full Name
mitochondrial ribosomal protein L38

MRPL38 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MRPL38 cDNA ORF Clone in Cloning Vector, Mouse MG52861-G
MRPL38 cDNA ORF Clone, Mouse, untagged MG52861-UT
MRPL38 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52861-ACGLN
MRPL38 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52861-ACG
MRPL38 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52861-ANG
MRPL38 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52861-ACR
MRPL38 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52861-ANR
MRPL38 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52861-CF
MRPL38 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52861-NF
MRPL38 cDNA ORF Clone, Mouse, C-His tag MG52861-CH
MRPL38 cDNA ORF Clone, Mouse, N-His tag MG52861-NH
MRPL38 cDNA ORF Clone, Mouse, C-HA tag MG52861-CY
MRPL38 cDNA ORF Clone, Mouse, N-HA tag MG52861-NY
MRPL38 cDNA ORF Clone, Mouse, N-Myc tag MG52861-NM

MRPL38 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MRPL38 cDNA ORF Clone in Cloning Vector, Human HG16759-U
MRPL38 cDNA ORF Clone, Human, untagged HG16759-UT
MRPL38 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16759-ACGLN
MRPL38 cDNA ORF Clone, Human, C-GFPSpark® tag HG16759-ACG
MRPL38 cDNA ORF Clone, Human, N-GFPSpark® tag HG16759-ANG
MRPL38 cDNA ORF Clone, Human, C-OFPSpark® tag HG16759-ACR
MRPL38 cDNA ORF Clone, Human, N-OFPSpark® tag HG16759-ANR
MRPL38 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16759-CF
MRPL38 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16759-NF
MRPL38 cDNA ORF Clone, Human, C-His tag HG16759-CH
MRPL38 cDNA ORF Clone, Human, N-His tag HG16759-NH
MRPL38 cDNA ORF Clone, Human, C-HA tag HG16759-CY
MRPL38 cDNA ORF Clone, Human, N-HA tag HG16759-NY
MRPL38 cDNA ORF Clone, Human, C-Myc tag HG16759-CM
MRPL38 cDNA ORF Clone, Human, N-Myc tag HG16759-NM
info info
添加购物车成功! 添加购物车失败!