MRPL16 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51790-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MRPL16 Reagents
CRO Services
Product recommended

All MRPL16 Reagents
MRPL16 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
756 bp
Description
Full length Clone DNA of Mouse mitochondrial ribosomal protein L16 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRPL16 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
2310039D06Rik cDNA ORF Clone, Mouse
MRPL16 Background Information
Full Name
mitochondrial ribosomal protein L16

MRPL16 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MRPL16 cDNA ORF Clone in Cloning Vector, Rat RG8A0109-U
MRPL16 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0109-ACGLN

MRPL16 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MRPL16 cDNA ORF Clone in Cloning Vector, Mouse MG51790-U
MRPL16 cDNA ORF Clone, Mouse, untagged MG51790-UT
MRPL16 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51790-ACGLN
MRPL16 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51790-ACG
MRPL16 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51790-ANG
MRPL16 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51790-ACR
MRPL16 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51790-ANR
MRPL16 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51790-CF
MRPL16 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51790-NF
MRPL16 cDNA ORF Clone, Mouse, C-His tag MG51790-CH
MRPL16 cDNA ORF Clone, Mouse, N-His tag MG51790-NH
MRPL16 cDNA ORF Clone, Mouse, C-HA tag MG51790-CY
MRPL16 cDNA ORF Clone, Mouse, N-HA tag MG51790-NY
MRPL16 cDNA ORF Clone, Mouse, N-Myc tag MG51790-NM
MRPL16 qPCR Primer Pairs, Mouse MP201663

MRPL16 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MRPL16 cDNA ORF Clone in Cloning Vector, Human HG14339-G
MRPL16 cDNA ORF Clone, Human, untagged HG14339-UT
MRPL16 cDNA ORF Clone, Human, C-GFPSpark® tag HG14339-ACG
MRPL16 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14339-ACGLN
MRPL16 cDNA ORF Clone, Human, N-GFPSpark® tag HG14339-ANG
MRPL16 cDNA ORF Clone, Human, C-OFPSpark® tag HG14339-ACR
MRPL16 cDNA ORF Clone, Human, N-OFPSpark® tag HG14339-ANR
MRPL16 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14339-CF
MRPL16 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14339-NF
MRPL16 cDNA ORF Clone, Human, C-His tag HG14339-CH
MRPL16 cDNA ORF Clone, Human, N-His tag HG14339-NH
MRPL16 cDNA ORF Clone, Human, C-HA tag HG14339-CY
MRPL16 cDNA ORF Clone, Human, N-HA tag HG14339-NY
MRPL16 cDNA ORF Clone, Human, C-Myc tag HG14339-CM
MRPL16 cDNA ORF Clone, Human, N-Myc tag HG14339-NM
MRPL16 qPCR Primer Pairs, Human HP102989
info info
添加购物车成功! 添加购物车失败!