MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Mouse, untagged

Cat: MG52533-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MPI/Mannose Phosphate Isomerase Reagents
CRO Services
Product recommended

All MPI/Mannose Phosphate Isomerase Reagents
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1272 bp
Description
Full length Clone DNA of Mouse mannose phosphate isomerase.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Mouse, untagged Alternative Names
1110002E17Rik cDNA ORF Clone, Mouse;AI315153 cDNA ORF Clone, Mouse;Mpi-1 cDNA ORF Clone, Mouse;Mpi1 cDNA ORF Clone, Mouse
MPI/Mannose Phosphate Isomerase Background Information
Full Name
mannose phosphate isomerase

MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MPI/Mannose Phosphate Isomerase cDNA ORF Clone in Cloning Vector, Mouse MG52533-G
MPI/Mannose Phosphate Isomerase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52533-ACGLN
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52533-ACG
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52533-ANG
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52533-ACR
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52533-ANR
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52533-CF
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52533-NF
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Mouse, C-His tag MG52533-CH
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Mouse, N-His tag MG52533-NH
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Mouse, C-HA tag MG52533-CY
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Mouse, N-HA tag MG52533-NY
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Mouse, C-Myc tag MG52533-CM
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Mouse, N-Myc tag MG52533-NM
MPI/Mannose Phosphate Isomerase qPCR Primer Pairs, Mouse MP202406

MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MPI/Mannose Phosphate Isomerase cDNA ORF Clone in Cloning Vector, Human HG17227-U
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Human, untagged HG17227-UT
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Human, C-GFPSpark® tag HG17227-ACG
MPI/Mannose Phosphate Isomerase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17227-ACGLN
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Human, C-OFPSpark® tag HG17227-ACR
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17227-CF
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17227-NF
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Human, C-His tag HG17227-CH
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Human, N-His tag HG17227-NH
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Human, C-HA tag HG17227-CY
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Human, N-HA tag HG17227-NY
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Human, C-Myc tag HG17227-CM
MPI/Mannose Phosphate Isomerase cDNA ORF Clone, Human, N-Myc tag HG17227-NM
info info
添加购物车成功! 添加购物车失败!