MPC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51281-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MPC2 Reagents
CRO Services
Product recommended

All MPC2 Reagents
MPC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
384 bp
Description
Full length Clone DNA of Mouse mitochondrial pyruvate carrier 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MPC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
0610006C01Rik cDNA ORF Clone, Mouse;2010002I07Rik cDNA ORF Clone, Mouse;2610205H19Rik cDNA ORF Clone, Mouse;AA108335 cDNA ORF Clone, Mouse;Brp44 cDNA ORF Clone, Mouse;ESTM43 cDNA ORF Clone, Mouse
MPC2 Background Information
Full Name
mitochondrial pyruvate carrier 2

MPC2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MPC2 cDNA ORF Clone in Cloning Vector, Rat RG8A4310-U
MPC2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A4310-ACGLN

MPC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MPC2 cDNA ORF Clone in Cloning Vector, Mouse MG51281-U
MPC2 cDNA ORF Clone, Mouse, untagged MG51281-UT
MPC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51281-ACGLN
MPC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51281-ACG
MPC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51281-ACR
MPC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51281-CF
MPC2 cDNA ORF Clone, Mouse, C-His tag MG51281-CH
MPC2 cDNA ORF Clone, Mouse, N-His tag MG51281-NH
MPC2 cDNA ORF Clone, Mouse, C-HA tag MG51281-CY
MPC2 cDNA ORF Clone, Mouse, N-HA tag MG51281-NY
MPC2 cDNA ORF Clone, Mouse, C-Myc tag MG51281-CM
MPC2 cDNA ORF Clone, Mouse, N-Myc tag MG51281-NM
MPC2 qPCR Primer Pairs, Mouse MP201163

MPC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MPC2 cDNA ORF Clone in Cloning Vector, Human HG23564-U
MPC2 cDNA ORF Clone, Human, untagged HG23564-UT
MPC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG23564-ACGLN
MPC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG23564-ACG
MPC2 cDNA ORF Clone, Human, N-GFPSpark® tag HG23564-ANG
MPC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG23564-ACR
MPC2 cDNA ORF Clone, Human, N-OFPSpark® tag HG23564-ANR
MPC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG23564-CF
MPC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG23564-NF
MPC2 cDNA ORF Clone, Human, C-His tag HG23564-CH
MPC2 cDNA ORF Clone, Human, N-His tag HG23564-NH
MPC2 cDNA ORF Clone, Human, C-HA tag HG23564-CY
MPC2 cDNA ORF Clone, Human, N-HA tag HG23564-NY
MPC2 cDNA ORF Clone, Human, C-Myc tag HG23564-CM
MPC2 cDNA ORF Clone, Human, N-Myc tag HG23564-NM
info info
添加购物车成功! 添加购物车失败!