MOG cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51046-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MOG Reagents
CRO Services
Product recommended

All MOG Reagents
MOG cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
783 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse myelin oligodendrocyte glycoprotein with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
HindIII + XbaI(6kb+0.78kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MOG cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MOG cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
Cynomolgus CD19/B4/CVID3 Gene Plasmid Map 5619
MOG cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
B230317G11Rik cDNA ORF Clone, Mouse
MOG Background Information

Myelin oligodendrocyte glycoprotein (MOG) is a transmembrane protein belonging to immunoglobulin superfamily, and contains an Ig-like domain followed by two potential membrane-spanning regions. MOG is expressed only in the CNS with very low content (approximately 0.1% total proteins) in oligodendrogliocyte membrane. Three possible functions for MOG were suggested: (a) a cellular adhesive molecule, (b) a regulator of oligodendrocyte microtubule stability, and (c) a mediator of interactions between myelin and the immune system, in particular, the complement cascade. A direct interaction might exist between the membrane-associated regions of MOG and the myelin-specific glycolipid galactocerebroside (Gal-C), and such an interaction may have important consequences regarding the membrane topology and function of both molecules. It is considered that MOG is an autoantigen capable to produce a demyelinating multiple sclerosis-like disease in experimental animals.

Full Name
myelin oligodendrocyte glycoprotein
References
  • Chekhonin VP, et al. (2003) Myelin oligodendrogliocyte glycoprotein: the structure, functions, role in pathogenesis of demyelinating disorders. Biomed Khim. 49(5): 411-23.
  • Hilton AA, et al. (1995) Characterization of cDNA and Genomic Clones Encoding Human Myelin Oligodendrocyte Glycoprotein. J Neurochem. 65(1): 309-18.
  • Johns TG, et al. (1999) The Structure and Function of Myelin Oligodendrocyte Glycoprotein. J Neurochem. 72(1): 1-9.
  • MOG cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    MOG cDNA ORF Clone in Cloning Vector, Mouse MG51046-G
    MOG cDNA ORF Clone, Mouse, untagged MG51046-UT
    MOG Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51046-ACGLN
    MOG cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51046-ACG
    MOG cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51046-ACR
    MOG cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51046-NF
    MOG cDNA ORF Clone, Mouse, C-His tag MG51046-CH
    MOG cDNA ORF Clone, Mouse, N-His tag MG51046-NH
    MOG cDNA ORF Clone, Mouse, C-HA tag MG51046-CY
    MOG cDNA ORF Clone, Mouse, N-HA tag MG51046-NY
    MOG cDNA ORF Clone, Mouse, C-Myc tag MG51046-CM
    MOG cDNA ORF Clone, Mouse, N-Myc tag MG51046-NM
    MOG qPCR Primer Pairs, Mouse MP201004

    MOG cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    MOG cDNA ORF Clone in Cloning Vector, Human HG10364-M
    MOG cDNA ORF Clone, Human, untagged HG10364-UT
    MOG Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10364-ACGLN
    MOG cDNA ORF Clone, Human, C-GFPSpark® tag HG29722-ACG
    MOG cDNA ORF Clone, Human, C-GFPSpark® tag HG10364-ACG
    MOG cDNA ORF Clone, Human, C-OFPSpark® tag HG10364-ACR
    MOG cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10364-CF
    MOG cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10364-NF
    MOG cDNA ORF Clone, Human, C-His tag HG10364-CH
    MOG cDNA ORF Clone, Human, N-His tag HG10364-NH
    MOG cDNA ORF Clone, Human, C-HA tag HG10364-CY
    MOG cDNA ORF Clone, Human, N-HA tag HG10364-NY
    MOG cDNA ORF Clone, Human, C-Myc tag HG10364-CM
    MOG cDNA ORF Clone, Human, N-Myc tag HG10364-NM
    MOG qPCR Primer Pairs, Human HP100399
    info info
    添加购物车成功! 添加购物车失败!