MMP-9 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50560-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MMP-9 Reagents
CRO Services
Product recommended

All MMP-9 Reagents
MMP-9 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2193 bp
Description
Full length Clone DNA of Mouse matrix metallopeptidase 9 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MMP-9 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
AW743869 cDNA ORF Clone, Mouse;B/MMP9 cDNA ORF Clone, Mouse;Clg4b cDNA ORF Clone, Mouse;MMP-9 cDNA ORF Clone, Mouse;pro-MMP-9 cDNA ORF Clone, Mouse
MMP-9 Background Information

Matrix metalloproteinases (MMPs) are neutral proteinases that are involved in the breakdown and remodeling of the extracellular matrix (ECM) under a variety of physiological and pathological conditions, such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. MMP9, also known as 92-kDa gelatinase B/type IV collagenase, is secreted from neutrophils, macrophages, and a number of transformed cells, and is the most complex family member in terms of domain structure and regulation of its activity. It plays an important role in tissue remodelling in normal and pathological inflammatory processes. MMP-9 is a major secretion product of macrophages and a component of cytoplasmic granules of neutrophils, and is particularly important in the pathogenesis of inflammatory, infectious, and neoplastic diseases in many organs including the lung. This enzyme is also secreted by lymphocytes and stromal cells upon stimulation by inflammatory cytokines, or upon delivery of bi-directional activation signals following integrin-mediated cell-cell or cell-extracellular matrix (ECM) contacts. Since the integrity of the tissue architecture is closely dependent of the delicate balance between MMPs and their inhibitors, excessive production of MMP-9 is linked to tissue damage and degenerative inflammatory disorders. As a consequence, regulation of gene transcription and tissue-specific expression of MMP-9 in normal and diseased states are being actively investigated to pave the way for new therapeutic targets. In addition, the dramatic overexpression of MMP-9 in cancer and various inflammatory conditions clearly points to the molecular mechanisms controlling its expression as a potential target for eventual rational therapeutic intervention.

Full Name
matrix metallopeptidase 9
References
  • St-Pierre Y, et al. (2003) Emerging features in the regulation of MMP-9 gene expression for the development of novel molecular targets and therapeutic strategies. Curr Drug Targets Inflamm Allergy. 2(3): 206-15.
  • St-Pierre Y, et al. (2004) Regulation of MMP-9 gene expression for the development of novel molecular targets against cancer and inflammatory diseases. Expert Opin Ther Targets. 8(5): 473-89.
  • Chakrabarti S, et al. (2005) Matrix metalloproteinase-2 (MMP-2) and MMP-9 in pulmonary pathology. Exp Lung Res. 31(6): 599-621.
  • MMP-9 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    MMP-9 cDNA ORF Clone in Cloning Vector, Rat RG80049-M
    MMP-9 cDNA ORF Clone, Rat, untagged RG80049-UT
    MMP-9 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80049-ACGLN
    MMP-9 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80049-ACG
    MMP-9 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80049-ACR
    MMP-9 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80049-CF
    MMP-9 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80049-NF
    MMP-9 cDNA ORF Clone, Rat, C-His tag RG80049-CH
    MMP-9 cDNA ORF Clone, Rat, N-His tag RG80049-NH
    MMP-9 cDNA ORF Clone, Rat, C-HA tag RG80049-CY
    MMP-9 cDNA ORF Clone, Rat, N-HA tag RG80049-NY
    MMP-9 cDNA ORF Clone, Rat, C-Myc tag RG80049-CM
    MMP-9 cDNA ORF Clone, Rat, N-Myc tag RG80049-NM
    MMP-9 qPCR Primer Pairs, Rat RP300047

    MMP-9 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    MMP-9 cDNA ORF Clone in Cloning Vector, Mouse MG50560-M
    MMP-9 cDNA ORF Clone, Mouse, untagged MG50560-UT
    MMP-9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50560-ACG
    MMP-9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50560-ACGLN
    MMP-9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50560-ACR
    MMP-9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50560-CF
    MMP-9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50560-NF
    MMP-9 cDNA ORF Clone, Mouse, C-His tag MG50560-CH
    MMP-9 cDNA ORF Clone, Mouse, N-His tag MG50560-NH
    MMP-9 cDNA ORF Clone, Mouse, N-HA tag MG50560-NY
    MMP-9 cDNA ORF Clone, Mouse, C-Myc tag MG50560-CM
    MMP-9 cDNA ORF Clone, Mouse, N-Myc tag MG50560-NM
    MMP-9 qPCR Primer Pairs, Mouse MP200552

    MMP-9 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    MMP-9 cDNA ORF Clone in Cloning Vector, Human HG10327-G
    MMP-9 cDNA ORF Clone, Human, untagged HG10327-UT
    MMP-9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10327-ACGLN
    MMP-9 cDNA ORF Clone, Human, C-GFPSpark® tag HG10327-ACG
    MMP-9 cDNA ORF Clone, Human, C-OFPSpark® tag HG10327-ACR
    MMP-9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10327-CF
    MMP-9 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10327-NF
    MMP-9 cDNA ORF Clone, Human, C-His tag HG10327-CH
    MMP-9 cDNA ORF Clone, Human, N-His tag HG10327-NH
    MMP-9 cDNA ORF Clone, Human, C-HA tag HG10327-CY
    MMP-9 cDNA ORF Clone, Human, N-HA tag HG10327-NY
    MMP-9 cDNA ORF Clone, Human, C-Myc tag HG10327-CM
    MMP-9 cDNA ORF Clone, Human, N-Myc tag HG10327-NM
    MMP-9 qPCR Primer Pairs, Human HP100367
    info info
    添加购物车成功! 添加购物车失败!