MLLT11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG52060-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MLLT11 Reagents
CRO Services
Product recommended

All MLLT11 Reagents
MLLT11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
273 bp
Description
Full length Clone DNA of Mouse myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MLLT11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
Af1q cDNA ORF Clone, Mouse;AI839562 cDNA ORF Clone, Mouse;Zfp692 cDNA ORF Clone, Mouse
MLLT11 Background Information
Full Name
myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11

MLLT11 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
MLLT11 cDNA ORF Clone in Cloning Vector, Canine DG70193-U
MLLT11 cDNA ORF Clone, Canine, untagged DG70193-UT
MLLT11 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70193-ACGLN
MLLT11 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70193-ACG
MLLT11 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70193-ANG
MLLT11 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70193-ACR
MLLT11 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70193-ANR
MLLT11 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70193-CF
MLLT11 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70193-NF
MLLT11 cDNA ORF Clone, Canine, C-His tag DG70193-CH
MLLT11 cDNA ORF Clone, Canine, N-His tag DG70193-NH
MLLT11 cDNA ORF Clone, Canine, C-HA tag DG70193-CY
MLLT11 cDNA ORF Clone, Canine, N-HA tag DG70193-NY
MLLT11 cDNA ORF Clone, Canine, C-Myc tag DG70193-CM
MLLT11 cDNA ORF Clone, Canine, N-Myc tag DG70193-NM

MLLT11 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MLLT11 cDNA ORF Clone in Cloning Vector, Rat RG81243-U
MLLT11 cDNA ORF Clone, Rat, untagged RG81243-UT
MLLT11 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81243-ACG
MLLT11 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81243-ACGLN
MLLT11 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81243-ANG
MLLT11 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81243-ACR
MLLT11 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81243-ANR
MLLT11 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81243-CF
MLLT11 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81243-NF
MLLT11 cDNA ORF Clone, Rat, C-His tag RG81243-CH
MLLT11 cDNA ORF Clone, Rat, N-His tag RG81243-NH
MLLT11 cDNA ORF Clone, Rat, C-HA tag RG81243-CY
MLLT11 cDNA ORF Clone, Rat, N-HA tag RG81243-NY
MLLT11 cDNA ORF Clone, Rat, C-Myc tag RG81243-CM
MLLT11 cDNA ORF Clone, Rat, N-Myc tag RG81243-NM
MLLT11 qPCR Primer Pairs, Rat RP301199

MLLT11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MLLT11 cDNA ORF Clone in Cloning Vector, Mouse MG52060-G
MLLT11 cDNA ORF Clone, Mouse, untagged MG52060-UT
MLLT11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52060-ACG
MLLT11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52060-ACGLN
MLLT11 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52060-ANG
MLLT11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52060-ACR
MLLT11 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52060-ANR
MLLT11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52060-CF
MLLT11 cDNA ORF Clone, Mouse, C-His tag MG52060-CH
MLLT11 cDNA ORF Clone, Mouse, N-His tag MG52060-NH
MLLT11 cDNA ORF Clone, Mouse, C-HA tag MG52060-CY
MLLT11 cDNA ORF Clone, Mouse, N-HA tag MG52060-NY
MLLT11 cDNA ORF Clone, Mouse, C-Myc tag MG52060-CM
MLLT11 cDNA ORF Clone, Mouse, N-Myc tag MG52060-NM
MLLT11 qPCR Primer Pairs, Mouse MP201933

MLLT11 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MLLT11 cDNA ORF Clone in Cloning Vector, Human HG20469-U
MLLT11 cDNA ORF Clone, Human, untagged HG20469-UT
MLLT11 cDNA ORF Clone, Human, C-GFPSpark® tag HG20469-ACG
MLLT11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20469-ACGLN
MLLT11 cDNA ORF Clone, Human, N-GFPSpark® tag HG20469-ANG
MLLT11 cDNA ORF Clone, Human, C-OFPSpark® tag HG20469-ACR
MLLT11 cDNA ORF Clone, Human, N-OFPSpark® tag HG20469-ANR
MLLT11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG20469-CF
MLLT11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG20469-NF
MLLT11 cDNA ORF Clone, Human, C-His tag HG20469-CH
MLLT11 cDNA ORF Clone, Human, N-His tag HG20469-NH
MLLT11 cDNA ORF Clone, Human, C-HA tag HG20469-CY
MLLT11 cDNA ORF Clone, Human, N-HA tag HG20469-NY
MLLT11 cDNA ORF Clone, Human, C-Myc tag HG20469-CM
MLLT11 cDNA ORF Clone, Human, N-Myc tag HG20469-NM
info info
添加购物车成功! 添加购物车失败!